پژوهنده )مجله پژوهشي دانشگاه علوم پزشکي شهيد بهشتي(
تاريخ دريافت مقاله: 4/5/3191
سال نوزدهم، شماره 5آذر ، و پي دی در 91پي 010 01، صفحات 180 تا 182 تاريخ پذيرش مقاله: 4/8/3191
فراواني ژنهای انتروتوکسين A و B در استافيلوکوکوس اورئوسهای جدا شده از شيريني و بيني کارکنان توليدکنندهی آنها در شهرستان خرم آباد، سال 0190
محمد حسنوند0، دکتر غلامرضا گودرزی*1، صياد خانيزاده1

3. کارشناس ارشد ميكروب شناسي، مرکز تحقيقات داروهای گياهي رازی، دانشگاه علوم پزشكي لرستان، خرم آباد، ایران
2. استادیار، مرکز تحقيقات داروهای گياهي رازی و گروه ميكروب شناسي، دانشگاه علوم پزشكي لرستان، خرم آباد، ایران
-10921207865

1. گروه ميكروب شناسي، دانشكده پزشكي، دانشگاه علوم پزشكي لرستان، خرم آباد، ایران چکيده
سابقه و هدف: انتروتوکسينهای A و B استافيلوکوکوس اورئوس، عوامل اصلي مسموميت غذایي در جهان ميباشند. تقریباباً 22 تا 55 درصد از بالغين سالم، در بخش قدامي بيني خود، با استافيلوکوکوس اورئوس، کلونيزه ميباشند. انتقاا اساتافيلوکوکوس اورئاوس هاا ی توليدکنندهی انتروتوکسين به شيرینيجات ،از طریق محصولات لبني آلوده و یا بيني کارکنان توليدکننده، ميتواناد خرار مساموميت غذایي را افزایش دهد .بر همين اساس، هدف از تحقيق حاضر ،تعيين فراواني ژنهای انتروتوکسا ينهاا ی A و sea( B و seb( در با ين سویههای استافيلوکوکوس اورئوس جدا شده از شيریني و بيني کارکنان توليدکنندهی آنها در شهرستان خرم آباد، در سا 3193 بود.
مواد و روشها: در این مرالعهی مقرعي- توصيفي، در مجموع 122 نمونهی شيریني باه هماراه 93 نموناه ساواب بينا ي از کارکناانتوليدکننده، به طور تصادفي جمعآوری گردید. نمونهها بر اساس دستورالعملهاا ی مؤسساه ی اساتاندارد و تحق يقاات صانعت ي ایا ران و آزمونهای ميكروب شناسي، از نظر حضور استافيلوکوکوس اورئوس، ارزیابي گردیدند. توزیع ژنهای sea و seb در بين ایزولههای مورد آزمایش، به روش PCR تعيين و به کمک آزمون Chi-square، مورد تجزیه و تحليل آماری قرار گرفت.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

يافتههاا : نتاا یج کشات نشاان داد کاه 1/33% از شا يرینيهاا ی خاماهای )352n( و 6/2% از شا يرینيهاا ی خشاک )352n(، باهاستافيلوکوکوس اورئوس، آلوده بودند) 25/2P<(. به علاوه ،48/36% از افراد مورد آزمایش، حامل باکتری در بيني خاود بودناد. فراواناي ژن sea در بين سویههای جدا شده از شيرینيهای خامهای، شيرینيهای خشک و بيني، به ترتيب 2/88%، 4% و 35% با ه دسات آماد )25/2P<(. این در حالي بود که ژن seb فقط در 2 سویه )8/33%( جدا شده از شيرینيهای خامهای ردیابي شد.
نتيجهگيری: مصرفي شيریني خامهای در مقایسه با شيریني خشک، احتما آلودگي به استافيلوکوکوس اورئوس را 6/4 برابار افازایش ميدهد) 6/4O.R(. پاستوریزه کردن و نگهداری مواد لبني در یخچا، کنتر ميكروبا ي ماداوم شايرینيجاات و غرباالگری کارکناانتهيهکنندهی آنها، ميتواند خرر مسموميت استافيلوکوکي را کاهش دهد.

-18287232458

واژگان کليدی: استافیلوکوکوس اورئوس، انتروتوکسین A و B، شیرینیجات، واکنش زنجیرهای پلیمراز، مسمومیت غذایی، خرم آباد لرفاً به این مقاله به صورت زیر استناد نمایيد:
Hassanvand M, Goudarzi G, Khanizadeh S. The frequency of enterotoxin A and B genes among Staphylococcus aureus strains isolated from confectionary products and nares of its processing workers in Khorramabad city (2012).
Pejouhandeh :)5(91;4102281-286.
5085497

مقدمه0
امروزه بيماریهای ناشي از مواد غذایي به عنوان یک معضل اساسي در سلامت محسوب شده و ساليانه هزینههای اقتصادی بالایي صرف درمان آنها ماي شاود. اساتافيلوکوکوس اورئاوس، دومين یا گاهي سومين عامل مهام مساموميت ناشاي از ماواد

*نويسنده مسؤول مکاتبات: دکتر غلامرضا گودرزی؛ گروه ميكاروب شناساي،دانشكده پزشكي، پردیس کمالوند دانشگاه علوم پزشكي لرستان، خرم آبااد، ایاران تلفن: 29320322552 پست الکترونيك: [email protected]
غذایي ميباشد) 3،2(. جنس اساتافيلوکوکوس دارای بايش از22 گون ه ب وده ک ه برخ ي از آنه ا در پوس ت، غ دد پوس تي ،غشاهای مخاطي جانوران وجود داشته و قادرند به فرآوردههای حيواني و منابع محيري از جمله خاک، آب و هوا، منتقل شوند )1(. ای ن ب اکتریه ا در ش رایط مس اعد از جمل ه اس ترس،بيماریهای ویروسي، آسيبهای بافتي و هر عاملي کاه ساببتضعيف در سيستم ایمني گاردد، سابب ایجااد پنوماوني، ورمپستان گاو، استئوميليت، انادوکاردیت، عفوناتهاای پوساتي و مسموميت غذایي ميشود) 4(. بر اسااس گازارشBergdoll ، منشااأ 95% از مسااموميتهااای غااذایي، انتروتوکسااينهااای باکتریایي ناشاي از انتروتوکساين هاای ناوعD ،C ،B ،A و E استافيلوکوکوس اورئوس بوده و 5% باقيمانده، مربوط به ساایرانتروتوکسينها ميباشد) 5(.
انتروتوکسااينهااای نااوع A و B بااه عنااوان مهمتاارین انتروتوکس ينه ای اس تافيلوکوکوس اورئ وس، عامال اص ليمسموميت غذایي در سراسر جهان محسوب شاده و بيشاترینمرالعات را به خاود اختصااد دادهاناد ) 1،6(. افازایش بازا، تهااوع، اسااتفرال، د پيچااه و اسااها ، از مهمتاارین علایاام مسموميت با انتروتوکسين استافيلوکوکي ميباشد) 0(. حضاورانتروتوکسينها در محصولات لبني مانند شير و پنير، گوشات،سبزیها و شيرینيها ميتواند باعث مسموميت غاذایي گاردد.به دليل مقاوم بودن انتروتوکسينهای اساتافيلوکوکي در برابارحرارت، در طي فرآیند پاستوریزاسيون، فعاليت بيولوژیكي خود را حفظ کرده و ميتوانند عامال مهماي در ایجااد مساموميتناشي از مواد غذایي به شمار آیند) 8،9(.
بارای شنااساایا اي ایا ان ساموم، روش ها اای مختا الفي از جملاا ه آگلوتيناساا يون لاتكاا س) 32(، الایاا زا) 33،32(، ایمونوکروماتوگرافي) 31( و مگنتياک ایمونواساي) 34( وجاوددارد. به دليل شباهتهای آنتيژنيک )واکنش متقاطع( در بين سروتایپهای مختلف انتروتوکسينها، روشهای ایمونولوژیاکفو در بسياری از موارد، از ویژگاي باالایي برخاوردار نيساتند)35(. در مقابل، روشهای تشخيصي مبتني بر اسيد نوکلئياکماننااد PCR و Real time-PCR، بااا تشااخي ژن هااای کدکنندهی انتروتوکسينها حتي ميتوانند ساویه هاایي را کاهميزان توليد سموم آنها پایين باوده و روش هاای ایمونولوژیاکقادر به ردیابي آنها نماي باشاند را تشاخي داده و باه همايندليل از حساسيت و ویژگي بالایي برخوردارند و ماي توانناد درکنار سایر روشها در تشاخي و پيشاگيری از مساموميتهاامؤثر باشند) 39-36(.
اگرچه استافيلوکوکوس اورئوس ميتواند در نواحي مختلافپوست و مخاط کلونيزه شود، اماا بخاش قادامي بيناي، محالاصلي کلونيزاسيون این باکتری ميباشد )22(. لذا افراد حامالاین باکتری، به ویژه تهيهکنندگان مواد غذایي، ماي توانناد باهعنوان مخزن بالقوهای در آلودگي مواد غذایي محساوب شاوند.
بر این اساس و با توجه به اهميت انتروتوکسينها در بهداشاتو سلامت جامعه ،هدف از انجام ایان مرالعاه، بررساي فراوانايژنهای کدکنندهی انتروتوکسين A و sea( B و seb( در بين استافيلوکوکوس اورئوسهای جدا شده از شيرینيجات و بينايپرسنل توليدکنندهی آنهاا در شهرساتان خارم آبااد در ساا 3193 بود.

مواد و روشها
جمعآوری نمونههاا و تیياين هويات در ایان مرالعاهی مقرعي-توصيفي، در مجموع 122 نموناه شايریني خاماهای و خشک به صورت کاملاًکاملا تصادفي، از بيش از 52 قنادی واقاع درسرح شهرستان خرم آباد در سا 3193، جماع آوری گردیاد.همچنين 93 نمونه سوآب بيناي از پرسانل شااغل در کارگااههای توليدی که از نمونه شيریني آنها استافيلوکوکوس اورئوس جداسازی شد، جمع آوری گردید. نمونههای شيریني در دمای 4 درجهی سانتيگراد نگهداری و در اولين فرصت به آزمایشگاه ميكروب شناسي مرکز تحقيقات داروهای گياهي رازی دانشگاه علوم پزشكي لرستان، منتقل و مورد آزمایش قرار گرفتند.
جداسازی استافيلوکوکوسهای کوآگولاز مثبت از نمونههای شيریني، بر اسااس دساتورالعملهاای م ؤسساه ی اساتاندارد وتحقيقات صنعتي ایران انجام گرفت. به طور خلاصاه، 32 گارماز هر نمونهی شيریني به 92 ميليليتر محلو رینگار اساتریلاضافه گردید )رقت 3/2(. سپس 322 ميكروليتر از هر نمونهی رقيق شده، روی محيط انتخابي برد پارکر آگار کشت داده شاد)23،22(. همچنين، نمونههای بيني با استفاده از ساوآب هاایپنبهدار موجود در لولههای حاوی محيط کشت تریپتيک سوی براث، از بخش قدام هر دو سوراخ بيني کارکنان شايریني پازیجمعآوری و روی محيطهای بلاد آگار و مانيتو ساالت آگاار، کشت داده شدند. کليهی پليتها به مدت 24 ساعت در دماای10 درجاه ی س انتيگ راد انكوب ه شادند. ب ا مش اهده ی رش د کلونيهای مشكوک به اساتافيلوکوکوس اورئاوس، بااکتریهااتوسط تستهایي چون رنا آميازی گارم، کاتاالاز، اکسايداز،DNAse ،کوآگولاز و تخميار ماانيتو ، تعياين هویات نهاایيشدند) 21(.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

استخراج DNA به منظاور اساتخرا DNA، ابتادا کشاتتازهای از سویههایهای اساتافيلوکوکوس اورئاوس جماعآوری شده، در محيط لوریا برتاني براث )مرک، آلمان( تهيه گردیاد وسپس 3 ميليليتر از سوسپانسيونهای باکتریاایي ، باا سارعت1222 دور در دقيقه، به مدت 5 دقيقه سانتریفوژ شد و پس از حذف مایع رویي، به 222 ميكروليتر از رسوب سلولي حاصال،22 ميكروليت ر محل و ليزواس تافين) Sigma ،322 µg/ml( اضافه گردید) 24(. مخلوط حاصل، باه مادت یاک سااعت دردمای 10 درجهی ساانتي تگراد انكوباه شاد و اداماه ی مراحالتخلي و جمعآوری DNA با استفاده از کيت ®AccuPrep

1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

آناليز آماری شايوع ژن هاای انتروتوکساينA و B در باينسویههای استافيلوکوکوس اورئوس، به صاورت درصاد فراوانايگزارش گردید. همچنين، مقایسهی فراواني ژنهای sea و seb در بين استافيلوکوکوس اورئوسهای جدا شده از شيرینيهاایخامهای و خشک، به کمک نرمافزار 36 SPSS و با اساتفاده ازآزمون Chi-squared، مورد تجزیه و تحليال قارار گرفات. درتمامي موارد ،P-value کمتر از 25/2، معنيدار تلقي گردید.

يافتهها
در این مرالعه، مجموعاً 122 نمونهي شايریني )خاماهای و خشک( و همچنين 93 نمونه سواب بيني از نظار آلاودگي باهاستافيلوکوکوس اورئوس و حضور ژنهای انتروتوکسين A و B توسط روش PCR مورد بررسي قرار گرفتند )شكل 3(. نتاایج کشااات نشاااان داد کاااه 23 نموناااه شااايریني) 0%( باااه استافيلوکوکوس اورئوس، آلوده بودند. همانطور که در جادو 2 باه تفكياک مش خ شاده اس ت، از 352 نموناه ش يرینيخامهای ،30 نمونه به استافيلوکوکوس اورئوس آلوده بودند ،که از ایان تعداد ،35 نمونه حاوی ژن انتروتوکسين A و 2 نموناه

شماره 5، پيدرپي 323، آذر و دی 3191 محمد حسنوند و همكاران / 281
پرایمرها) Annealing( در دمای 58 درجهی سانتيگاراد باهمدت 3 دقيقه، طویل شدن رشتههاا ) Extension( در دماای 02 درجهی سانتيگراد به مدت 3 دقيقه و طویل شدن نهاایي
)Final extension( در دماای 02 درجاه ی ساانتي گاراد باه مدت 8 دقيقه. در نهایت، 5 ميكروليتر از محصولات PCR با 3 ميكروليتر بافر نموناه ، مخلاوط و روی ژ آگاارز) 5/3 درصادوزني/حجمي در بافر TAE( به همراه ماارکر 52 جفات باازی)Fermentas, Lithuania( الكتروف ورز و ب ا ژ رد )ش رکت طيف آرا( رن آميزی گردید. در پایان، محصاولات الكتروفاورزشده پس از رویات در طاو ماو nm 262، توساط دساتگاه ژ داک، عكس بارداری شادند. همچناين، DNA دو ساویه ی استافيلكوکوس اورئوس حاوی ژنهاای انتروتوکساينA یااB )اهدایي آقای دکتر جليل فلاح، دانشگاه مالک اشاتر، تهاران(، به عنوان کنتر مثبت به هماراه نموناههاای ماورد آزماایش، استفاده گردید. Genomic DNA Extraction )شرکت Korea ،Bioneer( بر اساس دستورالعمل شرکت سازنده و با کمي اصلاحات ادامه یافت.
واکنش زنجيرهای پليمراز )PCR( توالي اوليگونوکلئوتيدی پرایمرهای مورد استفاده، درجادو 3 نشاان داده شاده اسات)25،26(. واکاانش Multiplex PCR در حجاام نهااایي 25 ميكروليتر شامل 122 نانوگرم DNA الگو ،3 واحد آنزیم TaqDNA Polymerase، 2/2 ميكرومااولار از هاار پرایماار، 4/2 ميل يم ولار مخل وط dNTP، 2 ميل ي م ولار 2MgCl و 5/2 ميكروليتر بافر) 32x( انجام پذیرفت. تكثيار همزماان ژنهاایمورد نظار در دساتگاه گرادیانات ترماا ساایكلر) BioRad, USA( تحت شرایط ذیل بهيناه گردیاد: بااز شادن اولياه دورشته در دمای 94 درجهی سانتيگاراد باه مادت 5 دقيقاه وسپس 15 چرخه با بااز شادن دو رشاته) Denaturation( در دم ای 94 درج هی س انتيگ راد ب ه م دت 3 دقيق ه، اتص ا

جدول 0 مشخصات اوليگونوکلئوتيدهای مورد استفاده جهت تکثير همزمان ژنهای انتروتوکسين A و seb ،sea( B(
ژن )  15( توالي اندازه قطیه (bp)
sea
F
R GGT TAT CAA TGT GCG GGT GG CGC CAC TTT TTT CTC TTC GG 322
seb F
R GGTGGTGTAACTGAGCGTA CCAAATAGTGACGAGTTAGG 364

شکل 0 الکتروفورز محصولات PCR حاصل از تکثير ژنهای انتروتوکسين A و M B، مااارکر bp51؛ س تون 0، محصااول PCR نمونااهی حاااوی ژن انتروتوکسااين sea( A(؛ سااتون 1، محصااول PCR نمونااهی حاااوی ژن انتروتوکسين seb( B(؛ ستون 1، استافيلوکوکوس اورئاوس فاقاد ژنهاا ی انتروتوکسين؛ ستونهای 4 و 5 به ترتيا ب محصاولاتPCR ساو يههاا ی کنترل مثبت حاوی ژنهای sea و seb
دارای ژن انتروتوکسين نوع B بودناد. از طرفاي، در باين352 نمونه شيریني خشک ،4 ماورد آلاودگي باه اساتافيلوکوکوساورئوس مشاهده شد که همگي آنها دارای ژن انتروتوکسين A بودند. همچنين، از کشت 93 نمونهی سواب اخذ شده از بينايکارکنان شايریني پازی ، 35 ساویه اساتافيلوکوکوس اورئاوسبهدست آمد که همهی آنها حامل ژن انتروتوکساينA بودناد .
این درحالي بود که هيچ ژن انتروتوکسين B ردیاابي نگردیاد.

جدول 1 فراواني ژنهای انتروتوکسين A و sea ،sea( B( استافيلوکوکوس اورئوس در نمونههای شيريني و بيني

)%( seb )%( sea تیداد نمونه آلوده%) ( تیداد نمونه
)33/0( 2 )88/2( 35 )33/1( 30 352 شيریني خامهای
)2( 2 )322( 4 )2/6( 4 352 شيریني خشک
)2( 2 )322( 35 )36/48( 35 93 سواب بيني
هيچ یک از 16 سویهی استافيلوکوکوس اورئوس بهدست آمده ،همازمان حامل هار دو ژن انتروتوکسين A و B نبودناد. طبق
محاسبات آماری، اختلاف بين شيرینيهای خاماه ای و خشاکاز نظر ميزان آلودگي به استافيلوکوکوس اورئوس و حضاور ژنانتروتوکسين A، معنيدار بود) 25/2P<(. به طور کلي، شايوعآلاااودگي در باااين شااايریني هاااای خاماااه ای، 1/33% و در شيرینيهای خشک، 0/2% بود که این اختلاف از نظار آمااری، معني دار بود )225/2P<(. به طور قابل توجهي، نتایج آزماونآماری نشان ميدهد که مصرف شيرینيهای خاماه ای، نسابتبه شيرینيهای خشک، شاانس آلاودگي باه اساتافيلوکوکوساورئوس را به ميزان 6/4 برابر افزایش ميدهد) 6/4O.R(.

بحث
مرالعات مختلفي که در ارتباط با حضاور اساتافيلوکوکوساورئوس در بيني افراد سالم انجام گرفته، حاکي از آن است کاهانتق ا ای ن ب اکتری از بين ي اف راد کل ونيزه، س بب اف زایش عفونتهای اساتافيلوکوکي مايگاردد. ميازان حااملين بيناياس تافيلوکوکوس اورئ وس در ب الغين ب ين 22 ت ا 55 درص د تخمين زده ميشود که از این بين ،حدود 32 تا 15 درصاد ازافراد، ناقل هميشگي استافيلوکوکوس اورئوس در بيني و 22 تا
05 درصد به طور متناوب، حامل آن ميباشند )20(.
در مرالعهی حاضار، از 93 نموناه ساواب بيناي، 35 نموناه)48/36%( حامل استافيلوکوکوس اورئوس بود که در مقایسه با سایر مرالعات )26،28(، ميازان کمتاری از افاراد حامال ایانباکتری بودند .در مرالعهی ناوروزی و همكااران، ميازان افارادحامل، 0/26% گزارش شد )26(. همچنين Rall و همكاران در برزیل، با بررسي سوابهای بيناي 68 نفار از تهياهکنننادگانمواد غذایي، ميزان حاملين استافيلوکوکوس اورئوس را 3/22% گاازارش کردنااد )28(. تفاااوت در حجاام نمونااه، موقعيااتجغرافيایي، سرح بهداشتي و همچنين ژنتيک افاراد )ناژاد( دراستعداد به کلونيزاسيون ،از جمله عواملي هستند که ميتوانند فراواني ناقلين بيني را تحت تأثير قرار دهند.
در مرالعاه ی حاض ر ،مي زان آل ودگي ب ه اس تافيلوکوکوس اورئ وس در ش يرینيه ای خام های و خش ک ني ز مقایس ه و گزارش گردید. بهطوریکه نتاایج کشات نشاان داد کاه 0% از نمونههای شيریني، به این باکتری آلوده هستند، کاه باه طاور قابل تاوجهي ، بيشاترین ميازان آلاودگي باه اساتافيلوکوکوساورئ وس، مارب اوط ب اه ش يرینيه ای خام های) 1/33( ب ود )جدو 2(. آلودگي شيرینيهای خامهای در سایر مرالعات نيز بررسي شده است. به عنوان مثا ، نتایج مرالعهی سلران دلا و همك اران در ته ران )32%( و همچن ين حس يني جزن ي وهمكاران در اروميه) 35%(، تقریباتقریباً مشابه مرالعهی حاضار باود)29،12(. ام ا در مرالع هی ني ک ني از و همك اران در تبری ز ،آلودگي شيرینيهاای خاماهای باه اساتافيلوکوکوس اورئاوس، تقریباتقریباً 1 برابر) 2/13%( مرالعهی حاضر بود) 13(.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

نتاایج آزم ون PCR نشااان داد ک ه تم امي 23 ایزولااهی استافيلوکوکوس اورئوس بهدست آمده از شيریني، حاوی یكاياز ژنه ای انتروتوکساين م ورد آزم ایش بودن د ) 322%(. در بررسي آلودگي مواد لبني به استافيلوکوکوس اورئوس، ایماانيو همكاران، بيشترین ميزان آلودگي را در خامه گزارش کردناد)38%(. اما بر خلاف مرالعهی حاضر، فقط 3/13% ساویه هاایاستافيلوکوکوس اورئوس جدا شده، قابليت توليد انتروتوکساينB ،A و یا هر دو را داشاتند کاه از ایان باين، 6/35%، 1/9% و
2/6% به ترتيب حامال ژن هاایseb ،sea و sea+seb بودناد
)36(. از طرفي، نتاایجPCR مرالعاه ی حاضار نشاان داد کاهتمااامي 35 سااویه) 322%( جاادا شااده از بينااي ، حاااوی ژن انتروتوکسين A ميباشند. به طور مشابهي، مرالعا هی Peck و همكااااران در کاااره نشاااان داد کاااه از باااين 95 ساااویه استافيلوکوکوس اورئوس جدا شده از بيني ،08 نمونه) 3/82%( دارای حداقل یک ژن انتروتوکسين ميباشند که در ایان باين،انتروتوکساااينهاااای G ،)%02/5( I )3/63%( و A )4/40%(، بيشترین فراواني را داشتند. نتایج تحقيق مذکور ،از نظار عادموجود انتروتوکسين B، با مرالعهی ما همخاواني داشات) 12(. همچنين، نوروزی و همكاران در بررسي 12 نمونه سواب بيني در تهران ،8 سویه استافيلوکوکوس اورئوس بهدست آوردند که در بين آنها، 2 سویه دارای ژن sea و 1 سویه حااوی ژنseb بود) 26(.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

به طور کلي، یافتههای این مرالعاه نشاان داد کاه مصارفشيرینيهای خاماه ای، احتماا انتقاا اساتافيلوکوکوسهاایانتروتوکسيژنيک را نسبت باه شايرینيهاای خشاک افازایشميدهند. خامه، به دليل ایجاد شرایط مغذی و رطوبت مناسب ،محيط مناسبي بارای رشاد بساياری از بااکتری هاا و قاار هاابهخصود در فصاو گارم ساا اسات) 29(. منشا أ آلاودگيشيرینيها، به ویژه شيریني خامهای، ميتواند به دليل آلاودگياوليهی شير، استفاده از خامههای محلي و غير پاستوریزه، عدم رعایت چرخهی سرما در حين نگهداری، آلاودگي وساایل و درنهایت، انتقا باکتری از دست و بيني پرسنل، در حين فرآوری و حمل و نقل باشد. این مرالعه برای نخستين بار نشان داد که در لرساااتان، ميااازان آلااودگي محصاااولات شااايریني باااهاستافيلوکوکوس اورئوس قابل توجه بوده و بسياری از کارکناانشيرینيپزی، حامل این باکتری ميباشند.
شماره 5، پيدرپي 323، آذر و دی 3191 محمد حسنوند و همكاران / 285
از جمله محدودیتهای این مرالعه باید باه حجام محادودنمونهها، تنوع کم مواد غذایي ارزیابي شده، عدم بررساي ساایرژنهای انتروتوکساين اساتافيلوکوکي) D ،C و غياره( و عادمارزیابي الگوی حساسيت آنتيبيوتيكي ساویه هاای جادا شاده،اشاره کرد. اگر چه حذف آلودگي در عمل، کار چندان سادهای نيست، اما با شناسایي ناقلين ساالم و کاانونهاای آلاودگي درمراکاز تهي هی ماواد غاذایي و در ماواردی درم ان م ؤثر ب ا آنتاايبيوتيااک، ماايتااوان بااروز مسااموميتهااای غااذایياستافيلوکوکي را به طور چشمگيری کاهش داد.

نتيجهگيری
نتایج این تحقيق نشان داد که با توجاه باه آلاودگي نسابتانسابتاًبالای شيرینيهاا و باه خصاود کلونيزاسايون بيناي پرسانلتوليدکنندهی آنها به اساتافيلوکوکوس هاای انتروتوکسايژنيک،ص نعتيک ردن تولي د محص ولات قن ادی، پاستوریزاس يون ونگهداری محصولات اوليه در یخچا ، کشات و کنتار ماداومميكروبي، غربالگری، فرهن ساازی و آماوزش بهداشاتي افارادتهيه کننده، ميتواند بار آلاودگي ميكروباي را کااهش و خرارمسموميتهای غذایي را به حداقل برساند.

تشکر و قدرداني
این تحقيق در آزمایشگاه ميكروب شناساي مولكاولي مرکازتحقيقات داروهای گياهي رازی انجام پاذیرفت. بادین وسايله،نویسندگان مقاله ،مراتاب ساپاس و تشاكر خاود را از کلياهی همكاران محترم این مرکز اعلام ميدارند.
REFERENCES
120853266603

Peles F, Wagner M, Varga L, Hein I, Rieck P, Gutser K, et al. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. Int J Food Microbiol 2007; 118(2): 186-93.
Balaban N, Rasooly A. Staphylococcal enterotoxins. Int J Food Microbiol 2000; 61(1): 1-.01
Loir YL, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res 2003; 2(1): 63-.67
Dinges MM, Dinges P, Orwin M. Exotoxin of staphylococcus aureus. Clin Microbiol Rev 2000; 13(1): 16-.43
Bergdoll MS. Enterotoxins. In: Easton CSF, Adlam C, editors. Staphylococci and staphylococcal infections. London: Academic Press; 1983. p. 559-.89
Barati B, Saadati M, Bahmani MK. Isolation and detection of enterotoxigenic Staphylococcus aureus type A by multiplex PCR. Military Med J 2006; 8(2): 119-28. (Full Text in Persian)
Balaban N, Rasooly A. Staphylococcal enterotoxins. Int J Food Microbiol 2000; 61(1): 1-.01
Ertas N, Gonulalan Z, Yildirim Y, Kum E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. Int J Food Microbiol 2010; 142(1-2): 74-.7
Akineden O, Hassan AA, Schneider E, Usleber E. Enterotoxigenic properties of Staphylococcus aureus isolated from goats’ milk cheese. Int J Food Microbiol 2008; 124(2): 211-.6
.01 Medina MB. Development of a fluorescent latex micro particle immunoassay for the detection of staphylococcal enterotoxin B (SEB). Agric Food Chem J 2006; 54(14): 4937-.24
.11 Wieneke A, Gilbert R. The use of a sandwich Elisa for the detection of staphylococcal enterotoxin A in foods from outbreaks of food poisoning. Lond Hygiene 1985; 95(1): 131-.8
.21 Bennett RW. Staphylococcal enterotoxin and its rapid identification in foods by and its rapid identification in foods by enzyme-linked immunosorbent assay-based methodology. Food Protect J 2005; 68(6): 1264-.7

.31 Khreich N, Lamourette P, Boutal H, Devilliers K, Creminon C, Volland H. Detection of Staphylococcus enterotoxin B using fluorescent immunoliposomes as label for immunochromatographic testing. Analytical Biochem J 2008; 377(2): 182-8.
Alefantis T, Grewal P, Ashton J, Khan AS, Valdes JJ, Delvecchio VG. A rapid and sensitive magnetic bead-based immunoassay for the detection of staphylococcal enterotoxin B for high-through put screening. Mol Cell Biol 2004; 18(6): 379-82.
Edwin C, Tatini SR, Maheswaran SK. Specificity and cross-reactivity of staphylococcal enterotoxin A monoclonal antibodies with enterotoxins B, C1, D, and E. Appl Environ Microbiol 1986; 52(6): 1253-7.
Imani-Fooladi AA, Riazipour M, Sattari M. Molecular and serological detection of Enterotoxigenic Staphylococcus aureus from traditionally dairy products. J Shahrekord Univ Med Sci 2010; 11(4): 19-27. (Full Text in Persian)
Cremonesi P, Luzzana M, Brasca M, Morandi S, Lodi R, Vimercati C, et al. Development of a multiplex PCR assay for the identification of Staphylococcus aureus enterotoxigenic strains isolated from milk and dairy products: Mol Cell Probes 2005; 19(5): 299-305.
Najera-Sanchez G, Maldonado-Rodriguez R, Ruiz Olvera P, Garza LM. Development of two multiplex polymerase chain reactions for the detection of enterotoxigenic strains of Staphylococcus aureus isolated from foods: J Food Prot 2003; 66(6): 1055-62.
Anvari SH, Sattari M, Forozandeh Moghadam M, Najarpeerayeh SH, Fouladi I. Detection of staphylococcus aureus entrotoxin A to E from Clinical sample by PCR. Res J Biological Sci 2008; 3: 826-9.
Khorvash F, Abdi F, Ataei B, Fattahi Neisiani H, Hasanzadeh Kashani H, Narimani T. Nasal carriage of Staphylococcus aureus: Frequency and antibiotic resistance in healthy adults. J Res Med Sci 2012; 17(Spec 2): S229S232.
Institute of Standards and Industrial Research of Iran. Microbiology of food and animal feeding stuffs-Enumeration of coagulase-Positive staphylococci (staphylococcus aureus and other species). Test method Part 1: Technique using Baird-parker agar medium. 1st ed. No: 6806-1; 2007.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Institute of Standards and Industrial Research of Iran. Microbiological of pastry and confectionary products: Specifications and test method. 1st Revision, No: 2395; 2005.
Monson Linda S. Staphylococci. In: Mahon Connie R, Lehman Donald C, Manuselis G, editors. Textbook of diagnostic microbiology. 4th ed, Saunders Company; 2011. p. 322-6.
Yadegar A, Sattari M, Amir Mozafari N, Goudarzi GR. Prevalence of the genes encoding aminoglycosidemodifying enzymes and methicillin resistance among clinical isolates of Staphylococcus aureus in Tehran, Iran. Microb Drug Resis 2009; 15(2): 109-113.
Chapaval L, Moon DH, Gomes JV, Duarte FR, Tsai SM. Use of PCR to detect classical enterotoxins genes and toxic shock syndrome toxin-1 gene (tst) in Staphylococcus aureus isolated from crude milk and determination of toxin productivities of S. aureus. Arq Inst Biol São Paulo 2006; 73(2):165-69.
.62 Nowroozi J, Goudarzi G, Pakzad P, Razavipour R. Isolation and detection of Staphylococcus aureus enterotoxins AE and TSSt-1 genes from different sources by PCR method. Qom Univ Med Sci J 2012; 6(3): 7-14. (Full Text in
Persian)
.72 Vandenbergh MFQ, Verbrugh HA. Carriage of Staphylococcus aureus: Epidemiology and clinical relevance. J Lab Clin Med 1999; 133: 525-.43
.82 Rall VLM, Sforcin JM, Augustini VCM, Watanabe MT, Fernandes JrA, Rall R, et al. Detection of enterotoxin genes of Staphylococcus sp isolated



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید