پژوهنده )مجله پژوهشي دانشگاه علوم پزشکي شهيد بهشتي(
تاریخ دریافت مقاله: 1/1/1191
سال نوزدهم، شماره مرداد 3و ، پي در شهریور پي3 63999، صفحات 611 تا 671 تاریخ پذیرش مقاله: 02/5/1191
جستجوی ژنومي کوکسيلا بورنتي )Coxiella burnetii( در شير بز به روش واکنش زنجيرهای پليمراز آشيانهای در شهرستان خرم آباد، ایران
پيمان خادمي*6، دکتر محمدرضا محزونيه1، دکتر عزیزاله ابراهيمي کهریزسنگي3، عماد شادروان4

1. کارشناس ارشد باکتری شناسی، گروه پاتوبیولوژی، دانشکده دامپزشکی، دانشگاه شهرکرد
دانشیار، گروه پاتوبیولوژی، دانشکده دامپزشکی، دانشگاه شهرکرد
استادیار، گروه پاتوبیولوژی، دانشکده دامپزشکی، دانشگاه شهرکرد
14996207611

4. کارشناس ارشد باکتری شناسی، گروه پاتوبیولوژی، دانشکده دامپزشکی، دانشگاه شهرکرد چکيده
سابقه و هدف: تب کیو، یک بیماری گستردهی جهانی است که دارای مراحل حاد و مزمن بووده و توسو بواکتری کوکسو یلا بوورنت ی ایجاد میشود. گلّگلههای گاو، گوسفندان و بزها، مخازن اصلی این بیماری هستند، ولی بسیاری از گونههای جانوری دیگر هو مویتواننود آلوده شده و ارگانیس را از طریق شیر دفع کنند. از دیگر راههای انتقال بیماری به انسان، خوردن شیر یو ا محصووت لننوی پاسوتور یزه نشده میباشد. این مطالعه، با هدف تعیین میزان شیوع فصلی کوکسیلا بورنتی در شیر خام جمعآوری شده از بزها در خورم آبواد انجوام شد.
مواد و روشها: این مطالعه به صور مقطعی- توصیفی، از اردینهشت 1190 تا دی ماه 1190 انجام شد. در مجموع، 54 نمونهی شیر از 8 گله بز به صور تصادفی از روستاها جمعآوری شده و از نظر حضور کوکسیلا بورنتی، به روش واکنش زنجیرهای پلیمراز آشو یانهای )Nested PCR( مورد آزمایش قرار گرفتند.
یافتهها: در این مطالعه، از مجموع 54 نمونهی بز، 02 نمونه) 48%( از نظر وجود کوکسیلا بورنتی، مثنت بود. تعوداد نمونوههوای فصولبهار، 02 نمونه و فصل پاییز، 14 نمونه بود. تعداد نمونههای مثنت در فصل بهار 18 )92%( و تعداد نمونههای مثنوت در فصول پواییز 8 )01%( بود.
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

نتيجهگيری: با توجه به جدول آمار توصیفی در مورد کل دادههای گردآوری شده در فصول و مناطق مختلف، مشاهده شد کوه حودود 48 درصد آنها مثنت بوده است. فصل و منطقه، روی میزان باکتری دفع شده تأثیر داشت. در مجموع، نتایج این پژوهش نشوان داد کوهشیر بز میتواند یکی از مخازن بالقوه کوکسیلا بورنتی در ایران باشد.

7630235054

واژگان کليدی: تب کیو، کوکسیلا بورنتی، شیر بز، خرمآباد، واکنش زنجیرهای پلیمراز آشیانهای لطفاً به این مقاله به صور زیر استناد نمایید:
Khademi P, Mahzounieh MR, Ebrahimi Kahrizsangi A, Shdravan E. Genomic detection of Coxiella burnetii in goat milk samples in animal farms Khorramabad Township, Iran. Pejouhandeh :)3(91;4102166‒172.
264264480

مقدمه6
تب کیو یا آنفلوانزای بزی، یک بیماری مشترک بین انسان و حیوان، با گسترش جهانی است که توس باکتری گورم منفوی میلهای داخل سلولی اجناری، به نوامکوکسو یلا بوورنت ی ایجواد میشود. کوکسیلا بورنتی از عوامل بیوتروریس بوده و کشوت ودستکاری نمونههای آلوده به آن بایستی در آزمایشگاههوای بوا
*نویسنده مسؤول مکاتباات : پيماان خاادمي؛ گوروه پواتوب یولوژی، دانشوکدهدامپزشکی، دانشوگاه شوهرکرد ؛ تلفون: 291292929148؛ پسات الکترونيا:
[email protected]
سطح ایمنو ی زیسوت ی 1 صوور گ یو رد. ایو ن میکروارگانیسو ، برخلاف بسیاری از اجرام غیر هاگدار نسنت به عوامل فیزیکی و شوویمایی نظیوور دمووای بووات، خشووک ی و بسوویاری از ضوود عفونیکنندهها، مقاوم بوده و دوز عفونوت زایوی پوا یینی دارد. از بین حیوانا اهلی، گاوهای شیری، گوسوفند و بوز، بوه عنووانمه ترین مخازن این باکتری به شمار مو یرونود . رحو و غوددپستانی حیوان، اولین محل جوایگزینی عامول بیمواری در فوازمزمن آلودگی با کوکسیلا بورنتی هستند. این میکروارگانیسو به میزان زیاد از طریوق ترشوحا دفعوی، ترشوحا رحموی وقطعاتی از جفت حیوانا آلوده بوه و یو ژه در طوی زایموان، بوهمحی دفع میشوود. یکوی دیگور از مهو تورین راه هوای دفوع
کوکسیلا بورنتی به محی ، شیر دامهای آلوده است. از این رو ،مصرف شیر غیر پاستوریزه آلوده، مننع انتقال عفونت به انسان است. این ارگانیس در محی به فرم شنه اسپور تندیل شده و به علت مقاومت به خشکی، حرار و ضد عفونی کنندهها، قادر است برای مد طوتنی در محی زنده بماند )4-1(.
بیماری در حیوانا فاقد علای بالینی، مشوخ نیسوت . اموابا این وجوود ، سوق جنوین، تولود نووزاد نوارس و نابواروری از مه ترین عوارض بیموار ی اسوت کوه در بوین حیوانوا اهلو ی گزارش شده است )4(. علای بیماری در انسوان بسویار متغیو ر بوده و حدود 22 درصد از افراد با تیتور سورم ی مثنوت ، علایو بالینی مشخصی از خود بروز نمیدهند. تب کیو در شکل حاد ،به صور بیماری آنفلوانزا، پنومونی یا هپاتیت غیر واضح بوروزمیکند. ایو ن بیموار ی وقووع ناگهوانی داشوته و در اصول یو ک بیماری شغلی محسوب میشود و معموتًمعموت در پرورش دهندگان حیوانا، شیردوشان، کارگران کشتارگاهها، کارکنان واحودهای تولید شیر، شاغلین کارخانههای چرم، روغن و کود و یو ا افورادشاغل در آزمایشگاه مشاهده میشود. کوکسیلا بورنتی تهواج زیادی داشته و ممکون اسوت حتوی یو ک سولول آن از طر یو ق تنفس، انسان را بیمار کند. راه اصلی انتقال عامول بیموار ی بوهانسان از طریق استنشاق ریز قطرهها و سوای ر راههوا شوامل راه گوارشی، گزش کنه و یا موارد تصادفی در آزمایشگاه مو یباشود )5 و 2(.
شیر به رغ فواید بسیار، میتوانود مننوع و وسویلهی انتقوالبسیاری از بیماریها باشد. شیر با داشتن صفا ممتاز غواا یی، به سورعت در معورض آلوودگیهوای گونواگون قورار دارد و در صورتی که بهداشت از مرحلهی دوشش تا مصرف رعایت نشود ،بیماریهایی از حیوان به انسان و از انسوان بوه انسوان منتقولمیکند. از مه ترین این بیموار یهوا موی تووان بوه توب مالوت)بروسلوز(، سل، لیستریوز )سوق جنوین و عووارض چشومی(، سالمونلوز )حصنه، شنه حصونه(، توب کیو و یو ا آنفلووانزا بوزی، اسهالهای خونی و ناراحتیهای گوارشی اشاره کرد )9(.
در برخی مطالعا انجام شده در نقاط مختلف جهان و ایران، درصدهای متفاوتی از آلودگی به کوکسیلا بورنتی گزارش شده اسوت. در س ال 1998، Lyytikainen و همک اران در آلم ان، باتترین میزان شیوع آلودگی گوسفندان به کوکسیلا بورنتی را در طول فصول زمسوتان و بهوار گوزارش کردنود )8(. در سوال0210، Astobiza و همک اران، در مطالع های ک ه روی 198 گله در کشور اسپانیا انجام دادند، نشان دادند کوه از بوین 198 گله ،119 گله از نظر حضور آنتیبادی ضد کوکسویلا بوورنتی، 129مثنت موی باشود )9(. در سوال 0229، در مطالعوه ی خلیلوی وسخایی در کرمان، تمام گلههای بز از نظور حضوور آنتویبوادی ضد کوکسیلا بورنتی مثنت بوده و از نظر فردی نیز بیش از 25 درصد از نمونههای سورمی بوزها، مثنت تشخی داده شود ند. در آن مطالعووه، ارتنوواط مسووتق یمی بووین مقوووادیر بووواتی )verdoseo( آنتوویبوووادی ضوود کوکسوویلا بووورنتی و شوود سروپازیتویتی )seropositivity( با سق ، مشواهده شود. ایو ن امر میتواند نشان دهندهی نقش احتمالی بز در این مناطق بوهعنوان مخزن مه باکتری برای انسان باشد )12(.
در سال 0212، در مطالعهی سرولوژیک انجوام شوده توسو خلیلی و همکاران که روی بیماران تبدار مشکوک به بروسلوز در بوردسیور )یکی از شهرهای دامپروری کرموان( انجوام شود، 04 درصد از موارد، از نظر آنتیبادی ضد کوکسیلا بوورنت ی فوازیک و 12 درصد از نظر آنتیبادی ضودکوکسو یلا بوورنت ی فوازدوم، مثنت بودند. نکتوه ی جالوب تحق یو ق آن بوود کوه شویوع س رولوژیک ت ب کی و از ش یوع س رمی ت ب مال ت ب ه ط ور معنیداری بیشتر بود )11(.
در سال 0224، Motohiko و همکاران، از مطالعهی خود در کشور ژاپن روی مقایسهی میزان حساسویت دو روشPCR و Nested-PCR در تشخی کوکسیلا بورنتی نتیجوه گرفتنودکه روش Nested-PCR، 12 برابر حساستر از PCR میباشد )10(.
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

اسووتان لرسووتان یکووی از کووانون هووای اصوولی کشوواورزی و دامپروری در ایران بوده و تولیدا داموی آن )گوشوت قرموز وشیر خام( از شهر خاصی برخوردار است. ایون اسوتان بوا دارابودن حدود 5/2 میلیون واحد دامی، 5/5 درصد جمعیت دامی کش ور را در خ ود ج ای داده و دارای رتن هی شش در ب ین استانهای کشور است. این شهر دارای آب و هوایی مدیترانهای معتدل و نیمه مرطوب بووده و دارای میزان بوارنودگی بسو یار، به خصوص در فصل بهار میباشد )11(. بات بودن تعداد بوز درگلههای در حال پرورش و مطرح شدن این حیو وان بوه عنووانگونهی دامی مه از نظر مخزن بودن برای انسوان بوه ویو ژه در آب و هوای معتدل و مرطوب، این گمان را بوه وجوود مویآورد که احتماتً باید آلودگی با باکتری کوکسیلا بورنتی در بین آنها وجود داشته باشد. از آن جا که اطلاعاتی در مورد نقوش بوز درپراکنده کردن این میکروارگانیس در منطقه در دست ننوود ه و با توجوه بوه اهمیو ت موضوو ع بورا ی احتموال آلوودگی انسوان،مطالعهی حاضر با هدف جستجوی ژنومی کوکسیلا بوورنت ی در شیر بز به روش واکنش زنجیرهای پلیمراز آشیانهای )Nested PCR( در شهر خرمآباد انجام گرفت.

1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

مواد و روشها
مناطق مورد مطالعه. هودف از ایو ن مطالعوه، تع یوی ن میو زان شیوع فصلی کوکسیلا بورنتی در شیر خام جموع آوری شوده ازبزها در خرمآباد بود. برای این منظور، دو شهرسوتان چگنوی و پلدختر به عنوان دو منطقهی متفاو از نظر آب و هوایی برای نمون هگی ری، انتخ اب ش دند. شهرس تان چگن ی دارای آب و هوایی گرم و معتدل است بوه نحووی کوه زمسوتانی معتودل و
تابستانی نسنتاًنسنتا گرم دارد. شهرستان پلودختر ، در جنووبی تورین ناحیهی استان لرستان و در مجاور استان خوزستان و ایولامقرار دارد. پلدختر در قسمت نیمه خشک استان لرسوتان قوراردارد )11(.
تعداد نمونه و روش نمونهگيا ری. ایو ن مطالعوه بوه صوور مقطعی- توصیفی، از بهار 1190 تا دی ماه 1190 انجوام شود.در این پژوهش در مجموع، 54 نمونهی شو یر از 8 گلوه بوز درمناطق مختلف شهرستان خرمآبواد در دو فصول بهوار و پواییز جمعآوری و مورد مطالعوه قورار گرفوت. تعوداد 02 نمونوه ، در فص ل به ار و 14 نمون ه در فص ل پ اییز گرفت ه ش د .جه ت نمون هگی ری ابت دا سرپس تانکه ای ه ر دام ب ا الک ل 92% ضدعفونی و نمونهی شیر تهیه میشد. پس از سانتریفوژ کردن نمونههوا ی شو یر و حواف چربوی از تیو هی رویوی آن، جهوتاستخراج DNA از رسوب حاصل بوا اسوتفاده از کیوتGene All cell SV mini 250 p )محصول شرکت Bioneer کورهجنوووبی( طنووق دسووتورالعمل س ازنده اسووتفاده شوود.DNA استخراج شده تا زمان انجام آزمون PCR، در فریزر 02- درجه سانتیگراد، نگهداری گردید.
مواد و روش جستجوی ژناومي. به منظور ردیابی کوکسیلا

128

شکل 6. محل جمعآوری نمونههای شير )پلدختر، دوره چگني( جهت مشخص شدن وضعيت شيوع کوکسيلا بورنتي در مناطق ذکر شده.
بورنتی در نمون هه ای ش یر ب ز، از روش Berri و همک اران
استفاده شد )14(. برای بررسی حضور DNA ژنومی کوکسیلا بورنتی در نمونههوا، روش آزموون واکونش زنجیورهای پلیمورازآشیانهای) Nested-PCR( به کار رفت. توالی آغازگرهای مورد استفاده برای تکثیر ژن com1 که کدکنندهی پروتئین غشوا ی خارجی کوکسیلا بورنتی میباشد، بور اسواس روش مطالعوهی Zhang و همکاران در سال 1998و Fretz و همکاران در سال
0229 بوود )15 و 12(. ب رای انج ام PCR در مرحل هی اول ،غلظت بهینهی مواد به کار رفته در واکنش، میزان مواد واکنش PCR در حجو نه ایی 05 میکرولیتو ر مط ابق بوا ج دول 1 و همچنین سیکلهای دمای مورد استفاده، مطابق بوا جودول 0، به کار گرفته شدند.

جدول 6. حجم مواد مورد استفاده در واکنش PCR.

مواد حجم
MgCl2 5/1میلیموتر
پرایمر 1 میکرولیتر با غلظت 12 پیکومول
پلیمراز Taq DNA 1/2 واحد
dNTP 1 میکرولیتر

بوورای PCR مرحلووه دوم، از پرایمرهووای OMP3 و OMP4 استفاده شد. در این مرحله، هموه ی شورای از قنیول مخلووطواکنشگرهای PCR و برنامهی زمانی و دمایی، مطابق مرحلوهاول اجرا شد. محصوت PCR حاصل از واکنش مرحلهی دوم، در ژل آگارز 1% حاوی اتیدیوم بروماید، الکتروفورز گردید و بوادسووتگاه تصووویربرداری از ژل) UVitec, UK( مشوواهده و بررسی شد.
طول قطعا DNA تکثیر یافته بوه روشPCR مربووط بوه
جفووت پرایمرهووای OMP3-OMP4 و OMP1-OMP2 بووه ترتیب 521 و 418 جفت باز بود )جدول 1(. در ایون بررسوی،کنترل مثنت DNA ژنومی کوکسیلا بورنتی استاندارد از کیت تشخیصو ی تجوار ی )K047, Genekam Biotechnology

جدول 3. پرایمرهای مورد استفاده در روش Nested-PCR برای جستجوی ژنومي کوکسيلا بورنتي در نمونههای شير بز )61 و 67(.

اندازه قطعه (bp) توالی پرایمر  → 15 پرایمر
106 AGTAGAAGCATCCCAAGCATTG TGCCTGCTAGCTGTAACGATTG OMP1

OMP2 مرحله اول
434 GAAGCGCAACAAGAAGAACAC TTGGAAGTTATCACGCAGTTG OMP3

OMP4 مرحله دوم
129

جدول 1. سيکلهای دمای مورد استفاده در انجام PCR.
دما )سانتيگراد( زمان
94 1 دقیقه باز شدن اولیه دو رشته (Denaturation)
94
52 45 ثانیه جهت باز شدن دو رشته
45 ثانیه اتصال پرایمرها به توالی هدف (Annealing) 12 چرخه دمایی
90 45 ثانیه 90 5 دقیقه مرحله نهایی جهت طویل شدن رشتههای جدید (Extension)

AG, Germany( و کنت رل منف ی ش امل مخل وط کلیوه ی واکنشگرهای PCR بدون حضور DNA در نظور گرفتوه شودکه در آن به جای DNA، آب مقطر استریل به لولههوا اضوافهگردید. دادههای حاصل، به کمک نسوخه ی نووزده نورمافوزارSPSS و با انجام آزمون آماری خیدو، موورد تجز یو ه و تحلیو ل قرار گرفتند. مرز معنیداری در 25/2>P قرار داده شد.

یافتهها
نتایج بررسی الکتروفورز محصووت مرحلوهی دوم PCR در ژل آگاروز نشان داد از مجموع 54 نمونهی شیر بوز، 02 نمونوهاز نظر وجود توالی اختصاصی ژن com1 در کوکسیلا بوورنت ی، مثنوت بودن د. در نمون ه ه ای مثن ت، بان د 418 جف ت ب ازی مشاهده شد) شکل 0(.

شکل 1. نتایج Nested-PCR نمونهها در ژل 6 درصد. ستون N: کنتارلمنف ي، ستونهای 6، 1، 4 و 1: نمونههای منفي، ستون M: مارکر 600 جفت بازی و ستونهای 3 و 1: نمونههای مثبت باند مورد نظر در ایا ن مرحلاه434 ميباشد. ستون P: کنترل مثبت کوکسيلا بورنتي.
با توجه به جدول آمار توصیفی در مورد کل دادههای گردآوری شده در فصول و مناطق مختلف، مشاهده شد کوه بویش از 48 درصد نمونهها، مثنت و حدود 50% درصد آنها، منفی میباشند )نمودار 1(. میزان آلودگی در بین نمونههوای مثنوت در فصولبهار، 18 عدد) 92%( و در بین نمونههای مثنت در فصل پاییز، 8 عدد) 01%( بود. با توجه بوه نتوایج بوه دسوت آموده، میو زان آلودگی در فصل بهار بیشتر از فصل پاییز بود )نمودار 0(.
بررس ی نتوایج نش ان م یده د اخ تلاف فراوان ی عفون ت کوکسیلایی در فصول مختلف، معنیدار بوده است) 25/2P<(. از این رو معلوم میگردد که فصل، روی فراوانی عفونوت توأثیر دارد. درصد مثنت و منفی گلههوا ی موورد مطالعوه در منواطقمختلف در جدول شماره 4 نشان داده شده است.

بحث
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

تب کیو به عنووان یو ک بیموار ی مشوترک انسوان و حیو وان )زئونوز( نوپدید و بازپدید در بسیاری از کشورها از جمله ایو ران مطرح شده است. اگر چه این بیماری جننهی شوغل ی داشوته ومعموتً در افرادی که در تماس با حیوانوا و محصووت آن هوا هستند، فراوانی بیشتری دارد. اما با توجوه بوه مقاوموت بوات ی عوامل بیماریزا در محی و قابلیت انتقوال آن از طوریق هووا ،
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

نمودار 6. ميزان درصد مثبت و منفي آلودگي به کوکسيلا بورنتي در شير بزهای منطقهی خرمآباد.

امکان آلودگی سایور افوراد جمعیت نیز وجوود داشته و اموروزهبه عنوان یکی از مخواطرا مهو سولامتی انسوان بوه صوور طنیعی و غیر طنیعی )بیوتروریس ( مطرح میباشد )14 و 19( مطالعووهی حاضوور، نخسووتین مطالعووه در اسووتان لرسووتانمیباشد. تعیین میزان شیوع بیماری و فاکتورهای خطر، باعو میشود که اهمیت این بیموار ی در جمعیو ت، بورا ی مسو ؤولین بهداشتی نمایو ان گردیو ده و امکانوا و تجه یو زا تزم جهوتکنترل و پیشگیری و نیز اولویتهای پژوهشی، مشخ شوود.
مطالعهی حاضر، نشان داد که عفونت کوکسیلوزیس در بزهوا ی شهرستان خرمآباد و اطراف آن وجود دارد و شوی وع آن در بوز ،
48% میباشد
در سال 0211، در مطالعهای توس عناسوی و همکواران، ازمجموع 092 نمونهی شیر، 10 نمونه یعنو ی 1/4% مثنوت بوود )18(. در سووال 1190، در مطالعووه سوورولوژ یک کووه توسوو بروجنی و همکاران در اهوواز رو ی گلوه هوای گوسوفند صوور گرفت، درصد شیوع سرمی تب کیو و 18/11% اعولام شود کوهنشاندهندهی آلودگی کمتر گوسفند نسنت به بز است )1(. در سال 0210، دوستی و همکاران مطالعهای روی 112 نمونوه ی
192

جدول 4. درصد مثبت و منفي گلههای مورد مطالعه در مناطق مختلف.

منفي مثبت تعداد نمونهها فصل منطقه گلهها
%18 %81 11 بهار دوره چگنی 1
%00 %99 9 بهار دوره چگنی 0
%122 2 9 پاییز دوره چگنی 1
%22 %11 9 پاییز دوره چگنی 4
%92 %12 12 پاییز پلدختر 5
%122 2 1 پاییز پلدختر 2
%52 %52 0 پاییز پلدختر 9
2 %122 1 پاییز دوره چگنی 8

نمودار 1. ميزان درصد مثبت و منفي آلودگي به کوکسيلا بورنتي در شير بزهای منطقهی خرمآباد بر اساس فصل.
خون شتر ایرانی بو ین مواه هوا ی او و سوپتامنر 0211 انجوامدادند. در این مطالعه، در مجموع 14 مورد) 92/12%( نمونوه ی خون شتر بوا روشPCR از لحوا حضوورکوکسویلا بوورنتی مثنت بودند که نشان میدهد شتر ه میتواند مخزن بالقوهی آلودگی برای انسان باشد )5(. در سوال 0210، Gyuranecz و همکاران، مطالعهای در کشوور مجارسوتان روی 015 نمونوه از تانکهای شیر انجوام دادنود کوه 9/22% از آنهوا از نظور وجوودکوکسیلا بورنتی مثنت بودند که مشابه نتایج بدسوت آموده دراین مطالعه است )19(. در بررسی کوارگر و همکواران در سوال0210، روی 122 نمونهی تهیه شده از شیر گاو در شهرسوتانجهرم، میزان شیوع آلودگی 11 درصود گوزراش شود )02(. در س ال 0211، در مطالع های توس خ انزادی و همک اران در خراس ان رض وی روی 01 نمون هی ش یر گوس فند، 8 نمون ه )98/14%( مثنووت بووود )01(. در سووال 0211، در مطالعووهی دیگری که توس قلیانچی و همکاران در استان ق انجام شود ، 14 نمونووه از مجموووع 122 نمونووه) 14%( مثنووت بووود )00(. همچنین در سال 1189، در مطالعهی رحیمی و همکاران روی 049 نمونوه ی شویر گ او در اصوفهان، 8 نمونوه از 049 نمون ه )0/1%( مثنت بود. شیوع کوکسیلا بوورنتی در فصوول مختلوفسال نیز متفاو بود. بواتترین میوزان وقووع) 2/8%( در فصولزمستان مشاهده شد، در حالی که تمام 25 نمونوه ی تابسوتان ، منفی بود )19(. مطالعا دیگر، طیفهوای مختلفو ی از وجوود
کوکسیلا بورنتی را در شیر گزارش کردهاند که به عنوان مثوال در کشور ژاپن 9/51 درصود و در کشوور ترکیو ه 1/14 درصود مثنت بودند )01 و 04(. نتایج مطالعا داخلی و بو ین المللو ی، میزان شیوع آلودگی به کوکسیلا بورنتی را از 4 توا 51 درصودگزارش کردهاند. اختلافا مشاهده شده ممکن است بوه علوتمتفاو بودن گونهی حیو وانی، محول جغراف یو ایی و در نتیجوه ، شرای آب و هوایی منواطق و نحووهی مود یریت باشود. انتقوالکوکسیلا بورنتی به طور عمود ه از طریو ق آیروسول هوای آلوودهانجام میگیرد )0 و 19( و ممکن اسوت پوایین بوودن رطوبوتنس نی ه وا و ش رای آب و ه وایی نس نتاًنتا گ رم و خش ک ب ه خصوص در شهرستان پلدختر در لرستان باع شوود کوه ایو ن آیروسلها به علت از دست دادن آب و سنک شدن برای مود طوتنی در هوا معلق مانده و مسافت طوتنیتری را طی کننودو در نتیجه موجب آلودگی سایرین شوند. از طرف دیگر، وجود رطوبت بات باع جاب آب توس آیروسلها و رسووب سوری ع آنها میشود.
استان لرستان از لحا تراک دام در کشور، رتنه اول را دارا میباشد به طوری که متوس تراک دام در واحد سطح در این استان ،002 واحد دامی در کیلومتر مربوع و در کشوور معوادل84 واحد دامی در کیلومتر مربع است )05(. لواا توراک بواتی حیوانا، احتموال انتشوار را در بوین آنهوا افوزایش مویدهود .
همچنین، تردد عشایر کوچ نشین از مناطق مختلف کشوور بوهاستان لرستان بات میباشد. شاید این عامل نیو ز در بوات بوودنمیزان آلودگی در استان لرستان و مناطق مطالعه شده، دخیولباشد. تفاو مشاهده شده در میو زان شو یوع در نقواط مختلوفجهان را میتوان به گوناگونی موقعیت جغرافیو ایی، چگوونگ ی و نوع روش بررسی، نوع و تعداد نمونههوای گرفتوه شوده، فصولسال و نمونهگیری در بین گلههای آلوده و غیر آلوده نیز نسنت داد. با توجه به این که میزان سق در مناطق مورد مطالعه بات میباشد )0 و 19(، پیشنهاد میشوود کوه در تحق یو ق دیگور ی اقدام به جستجوی کوکسیلا بورنتی در جنینهای سق شودهبا روش Nested-PCR گردد. نتایج مطالعوا پراکنوده انجوامشده در ایران نشان میدهد که تب کیو، احتماتً یو ک بیموار ی اندمیک در ایران بوده و نقش آن در تهدید سلامتی حیوانا و 191انسان، به دلیل فراوانی موارد تحت بالینی و عدم تموا یز موواردبالینی از بیماریهایی نظیر تب مالت و آنفلوانزا، بسو یار دسوتک گرفته شده است )1، 5، 19، 18، 02، 01، 00(.

نتيجهگيری
مطالعهی حاضر نشان میدهد که شیوع عامل توب ک یو و در جمعیت بزها، نسنتانسنتاً قابل توجه اسوت . بنوابرا ین تزم اسوت بوه عنوان یکی از عوامل مسنب سق در بز، توسو دامپزشوکان وسیاستگااران بهداشتی مورد توجه قرار گیرد. واکسیناسو یون، عامل بسیار مهمی در پیشوگ یری و کنتورل بیموار ی محسووبمیگردد. نتایج این مطالعه نشان داد که بزهای به ظاهر سوال ، میتوانند در انتقال کوکسیلا بورنتی نقش داشته باشند. با ایو ن وجود، برای بررسی دقیق آلودگی، انجام مطالعوا تکم یلو ی بواتعداد نمونوه ی بیشوتر ، ضوروری اسوت. از طرفو ی، بوه منظوورپیشگیری از انتشار عفونوت در بوین جمعیو تهوای حیو وانی و انسانی، کنترل کوکسلیوزیس در گلههای بز، از اهمیت بوات یی برخوردار است. همچنین، از آنجایی که کوکسو یلا بوورنت ی در حرار 21 درجه سانتیگراد به مد 12 دقیقه یو ا 90 درجوهسانتیگراد به مود 15 ثانیو ه، از بو ین مو یرود، مصورف شویر پاستوریزه میتواند یکی از راههای مؤثر پیشوگ یری از آلوودگ ی این باکتری در بین مصرفکنندگان باشد.
در کل، نتایج این پژوهش نشان داد که شو یر بوز مویتوانو د یکی از مخازن بالقوهی کوکسیلا بورنتی در ایران باشد. با توجه به اطلاعا به دست آمده در مییابی که فصل و منطقوه، رو ی میزان باکتری دفع شده، تأثیر دارد.

تشکر و قدرداني
ایو ن پوژوهش، برگرفتوه از پای انناموه ی دانشوجو یی مقط ع کارشناسی ارشد میباشود . مجریو ان پوژوهش بور خوود واجوبمیدانند که از مساعد و همکاری پژوهشکدهی بیموار یهوای مش ترک دانش گاه ش هرکرد، س رکار خ ان مهن دس یکتن ه، کارشناس پژوهشکدهی بیموار یهوای مشوترک کوه در انجواممراحل استخراج DNA و PCR ما را یاری نمودند و همچنین، مدیریت مرکز جهاد کشاورزی شهر معموتن، مهندس زینیوند و مهن دس مجتنووی رشوونو مس ؤول امووور دام، کووه مووا را درجمعآوری نمونهها همراهی نمودند، تقود یر و تشوکر بوه عمولآوردند.

1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:09 +0330 on Wednesday January 10th 2018

REFERENCES
123292666273



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید