پژوهنده )مجله پژوهشي دانشگاه علوم پزشکي شهيد بهشتي(
تاریخ دریافت مقاله: 81/81/8191 سال نوزدهم، شماره مرداد 3و ، پي در شهریور پي3 63999، صفحات 641 تا 656 تاریخ پذیرش مقاله: 12/5/8191
بررسي وجود باند ژنهای rsbA ،qseC ،luxS در باکتریهای اشریشيا کلي و پروتئوس ميرابيليس در بيماران مبتلا به عفونتهای دستگاه ادراری
سارا احمدی بادی*6، دکتر جميله نوروزی2، دکتر عباس اخوان سپهي3

8. کارشناس ارشد میکروبیولوژی، دانشکده علوم پایه، دانشگاه آزاد اسلامی، واحد تهران شمال
1. استاد، گروه میکروبیولوژی، دانشگاه آزاد اسلامی، واحد تهران شمال
-10921207866

1. دانشیار، گروه میکروبیولوژی، دانشگاه آزاد اسلامی، واحد تهران شمال چکيده
سابقه و هدف: با توجه به اهمیت فرآیند کروم سنسینگ و نقش بارز آن در بیماریزایی باکتریها و با توجه به شایع بودن عفونتهای ادراری و عوارض شناخته شدهی این بیماریها و خصوص یات بان د ژنه ای rsbA ،qseC ،luxS در برق رار ی ارتب ا ب ین گون ه ه ای باکتریایی، این تحقیق روی نمونههای ادراری آزمایشگاهها در سال 8191 انجام گرفت.
مواد و روشها: تحقیق به روش توصیفی روی 822 نمونهی ادراری جمعآوری شده از آزمایشگاههای مختلف انج ام گرف ت. تش خیص عفونت ادراری بر اساس کشت باکتریایی بوده و دو باکتری اشریشیا کلی و پروتئوس میرابیلیس با روشهای اختصاص ی تش خ یص داده شدند .DNA این نمونهها استخراج و با روش PCR، باند ژنهای rsbA ،qseC ،luxS جستجو و وجود آنها، بررسی و با آم ار توص یفی ارایه گردیدند.
یافتهها: از 822 نمونهی ادراری مورد بررسی، 55 درصد دارای اشریشیا کلی و 82 درصد دارای پروتئوس میرابیلیس بودند .همچن ین،در 02 درصد باکتریهای اشریشیا کلی، بان د ژنluxS و در 92 درص د آنه ا بان د ژنqseC و در 02 درص د ب اکتریه ای پروتئ وسمیرابیلیس، باند ژنهای luxS و rsbA دیده شد.
نتيجهگيری: به نظر میرسد وجود باند ژنهای مذکور به ویژه ژن luxS، در این باکتریهای عام عفون ته ای ادراری ش ایع اس ت.
بررسی تأثیر سرکوب بیان این ژنها بر بیماریزایی توصیه میشود.

-18287231609

واژگان کليدی: کروم سنسینگ، عفونتهای دستگاه ادراری، ژن luxS، ژن qseC ، ژن rsbA، اشریشیا کلی، پروتئوس میرابیلیس لطفاًلطفا به این مقاله به صورت زیر استناد نمایید:
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:07 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:07 +0330 on Wednesday January 10th 2018

Ahmadi Badi S, Nowroozi J, Akhavan Sepahi A. Detection luxS, qseC and rsbA genes’ bands in Proteus mirabilis and
Escherichia coli isolated from urinary tract infections. Pejouhandeh :)3(91;4102146‒151.
20325878

مقدمه6
بخشهای مختلف مجرای ادراری ب ا ی های از س لول ه ای پوششی )اپیتلیوم(، پوشیده شده است. به همین عل ت ، س ط اپیتلی ال مج رای ادراری، مس یر مناس بی ب رای ورود میکروارگانیسمها از خارج به داخ بدن است. اکثر عفونتهای مجرای ادراری، به علت با رفتن باکتریها به مج را ی فوق ان ی ادراری، ایجاد میشوند. باکتریهای مدفوعی، به ویژه اشریش یا کلی، بعد از تشکی کلنی در اطراف پیشابراه، احتمال دارد ک هبه طرف مجرای فوقانی ادراری، با بروند .از آنجا که باکتریها،

*نویسنده مسؤول مکاتبات: سارا احمدی بادی؛ دانشکده علوم پای ه، دانش گاهآزاد اسلامی، واحد ته ران ش مال؛ تلف ن: 29815255021؛ پستت الکترونيت:
[email protected]
به سهولت به مجرای ادراری وارد میشوند، جای تعجب نیست که عفونتهای مجرای ادراری از نظر فراوانی، در دومین رتبهی عفونتها ،یعنی فقط بعد از عفونتهای مج را ی تنفس ی، ق راردارن د. عفون ته ای مج اری ادراری ،در اول ین ردی ف ش یو عفونتهای باکتریایی در بزرگسا ن و مراجعه به پزش ق رارداشته و حدود 12% از عفونتهای خارج بیمارستانی را ش ام میشوند .بیشتر بیماران مبتلا به عفونتهای مج را ی ادراری را زنان تشکی میدهند. تش خ یص عفون ت مج رای ادراری، ب هکشت ادرار بستگی دارد. در ی بیم ار ب دون علا ی م ب ال ینی، تعداد 825 کلنی یا بیشتر در هر میلیلیتر ادرار، نشاندهندهی عفون ت اس ت. درم ان آنت یبی وتیکی ب ه کم تس ته ای حساسیت دارویی در آزمایشگاه، صورت میگی رد )8(. ب اکتریEscherichia coli، ش ایعت رین عام عفون ت در مج رای ادراری ب وده و ح دود 92% از عفون ته ای مج رای ادراری )bacteriuria( را در زنان، تش ک ی م یده د. علا ی م بیم ار ی شام تکرر ادرار، دفع ادرار همراه با س وزش، وج ود خ ون درادرار و گ اهی وج ود ک ر در ادرار اس ت. درد در ناح ی هی تهیگاه )flank(، با عفونت مج را ی ادراری، ارتب ا دارد. البت هعلایم فوق در عفونت با E. coli، اختصاصی نمیباشد. عفون تمجرای ادراری گاهی به باکتریمی و سپتیسمی منجر میگردد )1(.
پروتئوس میرابیلیس )Proteus mirabilis( عام 82% از عفونتهای دستگاه ادراری به حساب میآید و پنجمین عام ش ایع عفون ته ای دس تگاه ادراری بیمارس تانی اس ت. ای ن باکتری، روی کاتترهای ادراری قرار گرفته و با ایج اد بی وفیلم، باعث تشکی پوستهای روی کاتتر و مسدود شدن آن در ط ولعفونتهای ادراری شده و تعداد زیادی از بیماران دارای ک اتتردر بیمارستانها را آلوده میکند که ب ه هم ین دلی، نگران ی ویژهای به عنوان عام عفونتهای بیمارستانی به ویژه با ظهور سویههای مقاوم کند دارویی )MDR(، محسوب میگردد )1(.
با ش ناخت س یس تم ه ای ک روم سنس ینگ ک ه عب ارت از
برق راری ارتب ا ب اکتریه ا ب ا یک دیگر )ب ین گون هه ا و درونگون هه ای باکتری ایی( از طری ق تولی د و تش خیص سیگنالهای مولکولی شیمیایی میباشد )5(، در ای ن تحقی ق، وجود بان د ژنluxS ک ه یک ی از ژنه ای دخی در ارتب ا بینگونهای بوده و باعث تولی د آن ز یم س نتزکننده ی س یگنال 2-AI )خود القاگر-1( میگردد )5( و همچنین، بان د ژن ه ای qseC و rsbA که به ترتیب در باکتریه ای اشریش یا کل ی و پروتئوس میرابیلیس، پروتئینهای حسگر این س یگنال را ک دمیکنند )0 و0(، مورد بررسی قرار گرفت .برای این منظ ور ، در نمونههای افراد مبتلا به عفونته ای ادراری، ابت دا دو ب اکتری اشریش یا کل ی و پروتئ وس می رابیلیس، شناس ایی و س پس، بررسی وجود ژنهای مذکور در آزمایشگاه محمودیه، دانش گاهآزاد اسلامی واحد تهران شمال، در سال 8191، انجام شد.

مواد و روشها
در این مطالع ه ی توص یفی )cross sectional(، جامع ه ی مورد بررسی، ش ام 822 نمون هی ادراری ب ود ک ه از بهم ن 8198 ت ا اواس ط اردیبهش ت 8191، از کن دین آزمایش گاه تشخیص طبی در سط شهر تهران، جمعآوری شده بود. ابتدا، نمونههای ادراری، به منظور جداسازی ب اکتر یه ای اشریش یا کلی و پروتئوس میرابیلیس، در محیطهای کشت م کانکی و EMB کشت داده ش ده و به مدت 15 ساعت در انکوباتور 10
850
درج هی س انتیگ راد، نگه داری ش دند. س پس، از ت – کلنیهای ایجاد شده در محیطهای مذکور، برای رن گ آمی زی گرم، استفاده شد. پس از بررس یه ا ی میکروس کوپ ی و تأیی د خ الص ب ودن کش ت ب اکتریه ای گ رم منف ی، تس ته ای تشخیص ی افتراق ی، از جمل ه تس ت حرک ت،SIM ،TSI ، MRVP و سیمون سیترات، برای باکتریها انجام شد. پ س ازکشت باکتریها در محیطهای کشت افتراقی و نگه دار ی آنه اب ه م دت 15 س اعت در انکوب اتور 10 درج هی س انتیگ راد، نتیجهی تستها، بررسی و باکتریهای م ورد نظ ر جداس ازی شدند. با استفاده از کیت استخراج MBST، ژنوم باکتریه ای جداسازی و استخراج شده و سپس با انجام الکتروفورز روی ژل آگارز، صحت استخراج ژنوم، مورد تایید قرار گرفتند.
به منظور بررسی وجود باند ژنه ای qseC ،luxS وrsbA، واکنش PCR ب ا اس تفاده از پرایمره ا )ج دول 8( و برنام ه ی حرارتی و زمانی مشخص )جدول 1(، انجام گرفت. در مورد ژن luxS، برای باکتریهای پروتئوس میرابیلیس و اشریشیا کل ی، به ترتیب از پرایمرهای طراحی ش ده توس طStankowska و همک ارانش در س ال 1281 و Schneider در س ال 1221، استفاده شد. همچنین، با توجه به عدم وجود مقال ه ای در ای ن مورد، پرایمرهای مربو ب ه ژن ه ای rsbA و qseC از س ایت NCBI، بلاس ت و طراح ی ش دند. ب را ی بررس ی وج ود بان دژنه ای م ذکور پ س از انج امPCR ، ب ا اس تفاده از روش الکتروفورز روی ژل آگارز، فراوانی باند ژنه ا در ب اکتریه ای مورد مطالعه، بررس ی گردی د. وج ود ی ا فراوان ی 1 ژن م وردمطالعه در نمونهها، تعیین و میزان واقع ی آن ب ا اطم ین ان 95 درص د ).Confidence Interval – C.I( در جامع ه ، گ زارشگردید.

یافتهها
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:07 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:07 +0330 on Wednesday January 10th 2018

تحقیق حاضر ،روی 822 نمون ه ی ادراری انج ام گرف ت. از این تعداد، 55 درصد نمونهها دارای اشریشیا کلی و 82 درصد، دارای پروتئوس میرابیلیس بودند. وجود 1 ژن مورد بررسی ب هتفکی نو باکتری، در جدول 1 ارایه شده است. یافتهها نشان میدهند که در باکتریه ای اشریش یا کل ی، 02 درص د دارا ی بان د ژن luxS و 92 درص د دارای بان د ژن qseC و در باکتریهای پروتئوس میرابیلیس، 02 درصد دارای باند ژنهای luxS و rsbA میباشند. با توج ه ب ه ش یو 02 درص د ی ژن luxS در ب اکتریه ای اشریش یا کل ی، می زان واقع ی آن ب ا اطمینان 95 درصد، حداق 50 تا 05 درصد برآورد م یگ ردد )50 تا 05 درصد C.I95 (.
851/ دوماهنامه پژوهنده بررسی وجود باند ژنهای rsbA ،qseC ،luxS در باکتریهای …

جدول 6. پرایمرها، توالي ژنها و طول محصول مربوط به ژنهای qseC ،luxS و rsbA.

طول محصول )bp( توالی پرایمر ارگانیسم هدف
505 GTATGTCTGCACCTGCGGTA TTTGAGTTTGTCTTCTGGTAGTGC luxSF
luxSR پروتئوس میرابیلیس
8222 TTGGGATGACGCAACAGCA GAACGCCGTCAGCAGGAAA luxSF luxSR اشریشیا کلی
467 TTGAAGGACGCGATCAGACC ACTCTGCTGTCCTGTGGGTA rsbAF

rsbAR پروتئوس میرابیلیس
564 GTTGATGACGATGCGCTGAC ATCATCGTCAGAGAGCTGCG qseCF
qseR اشریشیاکلی

جدول 2. برنامه حرارتي و زماني PCR. جدول 3. توزیع باند ژنهای مورد مطالعه بر حسب باکتریهای جدا شده از نمونههای ادراری.

زمان )ثانیه( حرارت )درجه سلسیوس( مراح واکنش PCR
122 95 Pre-denaturation
02 95 Denaturation
55 51 Annealing
02 01 Extention
512 01 FinalExtention
19812-52034باکتری

باند

ژن

مجمو

qseC

rsbA

(
92
%
)
52

باکتری

باند

ژن

مجمو



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید