پژوهنده )مجله پژوهشي دانشگاه علوم پزشکي شهيد بهشتي(
تاریخ دریافت مقاله: 81/81/8198
سال نوزدهم، شمارهفروردین 1و ، پي در پي اردیبهشت 7797، 17 صفحات 79 تا 44 تاریخ پذیرش مقاله: 81/81/8191
مقایسه سلولهای بنيادی مزانشيمي مغز استخوان، چربي و القایي از نظر بيان ژنهای پرتواني
دکتر طاهره فروتن*1، محمد امين جاوید2، مهدی منوچهری7، دکتر طاهره ناجي4

8. گروه علوم جانوری، دانشکده علوم زيستی، دانشگاه خوارزمی، تهران
1. گروه ژنتيک مولکولی، دانشکده علوم زيستی، دانشگاه تربيت مدرس، تهران
1. گروه بيوتکنولوژی، دانشکده پزشکی، دانشگاه علوم پزشکی شهيد بهشتی، تهران
-10921207612

4. گروه سلولی، دانشکده علوم و فناوریهای نوين، واحد علوم دارويی، دانشگاه آزاد اسلامی، تهران چکيده
سابقه و هدف: با وجود پيشرفتهای گسترده در زمينهی کشت سلولهای بنيادی، هنوز انتخاب بهترين منبع سللولی کارآملد جهلت تزريق، قابل تأمل است. از آنجا که ميزان بيان ژنهای پرتوان، نشاندهندهی درجهی کارآمدی سلولهای بنيادی است، در ايلن تقييلق بيان برخی از ژنهای پرتوان از جمله oct4 ،klf-4 ،c-Myc و 2-sox در سلولهای بنيادی به دست آملده از سله منبلع بافلت رربلی ،مغز استخوان و اليايی، مورد ميايسه قرار گرفت.
مواد و روشها: تقييق به روش تجربی انجام گرفت. سلولهای بنيادی اليايی مورد استفاده در اين تقييق به صورت آماده تهيه شدند.
پس از تهيه، جداسازی و کشت، سلولهای بنيادی مزانشيمی مغز استخوان و رربی انسانی در پاساژ سوم، مارکرهلای سلیقی آنهلا بلاتکنيک فلوسيتومتری مورد ارزيابی و تأييد قرار گرفت. پس از طراحلی پرايمرهلای مناسلن ژنهلای oct4 ،klf-4 ،c-Myc و 2-sox و همچنين ژن GAPDH )به عنوان ژن کنترل(، بيان ژنهای فوق در سه منبع سلولهای بنيادی توسط real time PCR مورد ميايسه قرار گرفت.
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

یافتهها: بيان ژن c-Myc در سلولهای بنيادی رربی بيشترين ميدار را به خود اختصاص داد و بعد از آن به ترتين، سلولهای بنيادی اليايی و مغز استخوان قرار گرفتند. ژن 4-klf در سلولهای بنيادی مشتق از رربی و سلولهای اليلايی ، تيريبلا بله يلک ميلزان بلود واختلاف معناداری با يکديگر نداشتند و سلولهای مغز استخوان کمترين ميزان را به خود اختصاص دادنلد. سللولهلای مغلز اسلتخوان، بيشترين ميزان بيان oct که مهمترين مارکر سلولهای بنيلادی جنينلی اسلت را از خلود نشلان داد. پلس از آن سللولهلای اليلايی وسلولهای رربی، بدون اختلاف معنادار نسبت به يکديگر، در رتبههای بنمودعدی قرار گرفتند. بيان ژن 2-sox در سللول هلای بنيلادیمزانشيمی مغز استخوان، بيش از دو گروه ديگر بود.
نتيجهگيری: سلولهای بنيادی مزانشيمی مغز استخوان در ميايسه با سلولهای بنيادی اليايی و سلولهای بنيلادی مشلتق از رربلی، منبع مناسنتری در کاربردهای سلولدرمانی میباشند.

-18287234624

واژگان کليدی: سلولهای بنيادی اليايی، مغز استخوان، رربی لیفا به اين مياله به صورت زير استناد نماييد:
Foroutan T, Javid MA, Manoochehri M, Naji T. Comparison of expression of reprogramming genes of induced pluripotent stem cells and mesenchymal stem cells derived bone marrow and adipose tissues. Pejouhandeh
:)1(91;410237‒44.
20324735

مقدمه1
سلولهای بنيادی، از نظر منشأ و ميزان پلاستيسيتی، بله دو دسته تيسيم میشوند. سلولهای بنيادی بالغ که در بافتهل ا و

*نویسنده مسؤول مکاتبات: دکتر طاهره فروتن؛ گروه علوم جانوری، دانشلکده عل وم زيس تی، دانش گاه خ وارزمی، ته ران، نم ابر: 11141941 )118(؛ پستتت الکترونيك: [email protected]
اندامهای فرد بالغ يافت میشوند و سلولهای بنيلادی جنينلی کله از تلوده ی سللولی داخللی بلاستوسيسلت رويلان ، حاص ل میشوند. سلولهای بنيادی بالغ، از دستهی سلولهای بنيلادی مزانشيمی رند توان مقسوب میشوند )7-8( که پس از تمايز انواع سلولها از جمله سلولهای استخوانی، غضروفی، رربلی و حتی سلولهای غير مزودرمی و انلدودرمی مثلل هپاتوسليت و
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

11
نورون را بل ه وجلود ملی آورنلد ) 1(. ايلن سللولهلا کله دارای کاربردهای فراوانی در طن ترميمی میباشند، از منابع مختلفی مانند مغز استخوان، رربی، فوليکول مو و خون مقيیی بدست میآيند. سلولهای بنيادی مشتق از رربی، امتيازاتی از جمللهدر دسترس بودن و قدرت تکثير بالا دارند. در حال حاضلر کله راقی به صلورت مشلکل اپيلدميک درآملده و عملل جراحلی ليپوساکشن متداول شده است، بافت رربی به عنوان يک منبع نامقدود و میمئن در زمينهی سللول هلای بنيلادی بله شلمارمیرود. برخلاف مغز استخوان، بيوپسی از بافلت رربلی، بلدوندرد بوده، ضمن آنکه مقدوديت اخلاقلی در بدسلت آوردن آن وجود ندارد. سلولهای رربی، برای پيونلدهای خلودی، ايملنبوده و میتوانند جايگزين خوبی برای سلولهای بنيادی مشتق از مغز استخوان مقسوب شوند. اين سلولها، قابليت پيوند بلهبافت اتولوگوس )خلودی( و نيلز بافلت آلوژنيلک )غيرخلودی(داش ته و ايمونوژنيس يتهی کم ی دارن د )88-9(. س لوله ای بنيادی مشتق از مغز استخوان، به کشت اوليه با ميزان رگلالیخيلی بالاتر از 01 هزار سلول در هر سانتیمتر مربع نياز دارند، در حالی که سلولهای بنيادی مشتق از رربلی ملیتواننلد درميادير کمتر از 1111 سلول در هر سانتیمتر مربلع ، کشلت ونگهداری شوند) 81(. ميزان تکثير فراوان و قدرت تهلاجم کلمپس از جراحی، از جملله مزايلای سللول هلای بنيلادی رربلی جهت استفاده در سلولدرمانی مقسوب میگردد.
سلولهای بنيادی جنينی و سلولهای بنيادی پرتوان اليايی، دارای خاصيت ايمونوژنيسيتی بوده و بافتهای آلوژن و اتولوگ را پس میزنند. اين در حلالی اسلت کله سللولهلای بنيلادیمشتق از مغز اسلتخوان بعلد از پيونلد آللوژن، ايمونوژنيسليتیکمی از خود نشان میدهنلد )81 و 84(. سللول هلای بنيلادی رربی، بدون آنکه پاسخ ايمنی داشته باشل ند، پتانسليل خلوبیب رای پيون د آلوژني ک دارن د) 80(. همچن ين ،آنت یژنه ای کمتری را بيان کرده و باعث عدم پسزدگی در حين پيونلد بلاسلولهای آلوژنيک میشوند) 81(. سللول هلای بنيلادی بلالغ ، دارای مق دوديته ايی در ک اربرد هس تند ک ه از آن جمل ه میتوان به نلاتوانی در تکثيلر نامقلدود در کشلت و همچنلينکاهش تعداد و تمايزشان در اثر افزايش سن، اشاره نمود) 87- 11 (. سلولهلای بنيلادی جنينلی در ميايسله بلا سللول هلای بنيادی بالغ، خصوصيات پرتلوان ی بيشلتر ی داشلته و قلادر بلهايجاد تمامی انواع سلولی میباشند. بر خلاف سلولهای بنيادی بالغ، اين سلولها میتوانند بل ه طلور نامقلدود ، کشلت شلده و پلاستيسيتی خود را حفظ نمايند )11-18(. بل ه دليلل رعايلتمسألهی اخللاق در پزشلکی، توليلد و اسلتفاده از سللولهلای بنيادی جنينی انسانی، با مقدوديتهايی مواجه است. امروزه با روش برنامله ريلزی مجلدد سللول هلای سلوماتيک ، آنهلا را ب ه سلولهای بنيادی شبه جنينلی تبلديل ملیکننلد . ايلن عمللتوسط وکتورهای ناقل ژنهای پرتوانی از جمللهklf- ،c-Myc 4، oct4 و 2-sox ص ورت مللیگيللرد )17-14(. سلللولهللای بنيادی حاصل را سلولهای بنيادی پرتوان اليايی مینامند.
با توجه به مزايا و معاين ذکر شلده بلرای انلواع سللولهلای بنيادی، در اين میالعله بلر آن شلديم سله منبلع سللولهلای بني ادی پرت وان الي ايی، مزانش يمی مش تق از ررب ی و مغ ز استخوان را از نظر ميزان بيان رهار ژن پرتوانی klf- ،c-Myc
4، oct4 و 2-sox با يکديگر مورد ميايسه قرار دهيم.

مواد و روشها
تهيه، جداسازی و کشت سلولهای بنيتادی مزانشتيميمشتق از بافت چربي
در میالعهی تجربی حاضر، کليهی موارد اخللاق در پزشلکیرعايت گرديده است. بافت رربی دور شکم توسط کلاژنلاز نلوع4 کللاملا خللرد و همللوژن شللده و پللس از سللانتريفوژ، بلله فلاسکهای سلولی حاوی مقيط کشت FBS %81 ،DMEM
(Fetal Bovin Serum) )شللرکت Gibco، آلملان( و 811 mg/ml پن یس يلين- استرپتومايس ين، در دم ای 17 درج ه سلانتیگ راد و 0% 2CO، انکوب ه ش دند. پ س از کانفلو س ی مناسن سلولها، پاساژ انجام پذيرفت.
تهيه، جداسازی و کشت ستلول هتای مزانشتيمي مغتزاستخوان
پس از مخلوط کردن مغز استخوان انسانی بلاDMEM ، آن را روی ف ايکول ب رده و پ س از جداس ازی س لوله ای ت ک هستهای، طی رندين پاساژ، سلولهای بنيلادی مزانشليمی ازآنها جدا گرديد. سلولهای پاساژ 1-4، برای بيان ژنهای مورد نظر در اين تقييق مورد استفاده قرار گرفلت )8(. سللول هلای پرتوان اليايی مورد نياز اين تقييق به طور آماده تهيه گرديد.
فلوسایتومتری
سلولهای بنيادی مزانشيمی رربی و مغلز اسلتخوان از نظلر
بي ان مارکره ای س یقی CD90 ،CD105 و CD34، م ورد ارزيابی قرار گرفتند. به ميزان 0×811 سلول پاساژ سوم پس از شستشو با آنتیبادی کونژوگه، با فلوروکروم فيکواريترين بر ضد مارکرهای فوق، رنگ شدند )8(.
Real-Time PCR واکنش
استخراج RNA. استخراج RNA با استفاده از يک ميلیليتر تراي زول )Invitrogen( ب ه ازای ه ر فلاس ک انج ام گرف ت .مقتويات داخل فلاسک به ميکروتيوب منتيل و پس از افزودن 111 ميکروليتر کلروفرم به آن، به مدت 80 دقييه در دمای 4 درجللهی سللانتیگللراد و بللا سللرعت 8111 دور در دقييلله، سانتريفوژ شد. فاز رويلی حلاویRNA بل ه آرامل ی جلدا و بلهتيوپهای فاقد RNase منتيل شد. مخلوط فوق 11 دقييه در دمللای 11- درجللهی سللانتیگللراد قللرار داده شللد. پللس ازسانتريفوژ، مايع رويلی جلدا و بله رسلوب داخلل تيلوب، يلکميلیليتر اتانول 70% اضلافه شلد . مقصلول ، در 7011 دور در دقييه سلانتريفوژ شلد. رسلوب بلاقیمانلده ، در 11 ميکروليتلر DEPC treated water حل گرديد.
سنتز cDNA از RNA. برای سنتز cDNA در اين تقييق از کيت Takara Bio( Primescript RT reagent( استفاده شد. بايد توجه شود که کليهی مراحل، با وسايل و مقلولهلایعاری از RNase انجلام گيلرد . همچنلين بله منظلور سلاختcDNA هايی با غلظت يکسان، در مورد هر نمونه، با توجه بلهغلظت RNA، حجمی را برداشته که در آن بله ميلزان 8111 نانوگرم RNA موجود باشلد و بلا آب وMaster Mix ، حجلمنهايی به 11 ميکروليتر برسد.
طراحي پرایمر. به منظور تکثير هر قیعهی ژنی، يلک جفلتپرايمر اختصاصی برای هر ژن انتخاب شلد کله شلامل پرايملرفوروارد و معکوس بود. طراحی پرايمرها توسلط نلرم افزارهلای
Perl primer ،Gene runner و Allel ID صورت گرفت. بلهمنظ ور جل وگيری از تکثي ر DNA ژن ومی، پرايمره ا ط وری طراحی شدند که اتصالات اگزونی را تکثير نماينلد . بله عبلارتديگر، از هر جفت پرايمر، هر يک به يکی از دو اگلزون مجلاورمتصل میشدند. بدين ترتين، واکنش PCR بله نفلع قیعلهی کورک حاصل از الگلویcDNA و نلهDNA ژنلومی حلاویتوالی اينترونی، پيش میرفت؛ يا اينکه پرايملر بله مقلل ملرزاتصال دو اگزون متصل میشد که در اين صورت تنها قلادر بلهتکثيلر cDNA میبلاشلد. تواللی و طول قیعلهی حلاصلل از

1562811-1529289

CD90 CD34 CD105

نمودار 1. بيان مارکرهای CD90 و CD105 و عدم بيان مارکر CD34 در سلولهای بنيادی مغز استتخوان درپاساژ سوم ) نمودار بالا( و سلولهای بنيادی مشتق از بافت چربي )نمودار پایين.(

19
پرايمرهای مورد استفاده در ذيل آورده شده است:

c-Myc: F:CACCAGCAGCGACTCTGA R:GATCCAGACTCTGACCTTTTGC
Klf4: F:GGGAGAAGACACTGCGTCA
R:GGAAGCACTGGGGGAAGT sox-2: F:TGCTGCCTCTTTAAGACTAGGAC R:CCTGGGGCTCAAACTTCTCT oct4: F:GAAACCCACACTGCAGATCA R:CGGTTACAGAACCACACTCG
GAPDH: F:AGCCACATCGCTCAGACAC
R:GCCCCAATCCGACCAAATCC

یافتهها
تصاوير سللول هلا ی بنيلاد ی مشلتق از رربلی در پاسلاژ 1 و کشت اوليهی سلولهای تکهستهای مغلز اسلتخوان در کنلارکلنی سلولهای بنيادی اليلاي ی، در شلکل 8 نشلان داده شلدهاست. در ايلن میالعله، بيلان مارکرهلا ی CD90 و CD105 و ع دم بي ان م ارکر CD34 توس ط س لوله ای بني ادی مغ ز استخوان و مشتق از بافت رربی، نشلان داده شلد )نملودار 8(. ژن klf4 در سلولهای بنيادی مشتق از رربل ی و سللول هلا ی پرتوان اليايی، تيريبا به يک ميزان بود و اختلاف معنلا داری بلاهم نداشتند و سلولهای مغز استخوان کمتلرين ميلزان را بلهخللود اختصللاص دادنللد )نمللودار 1(. بيللان ژن c-Myc در سلولهای بنيادی رربی، بيشترين ميدار را به خود اختصلاصداد و بعد از آن بل ه ترتيلن سللولهلا ی پرتلوان اليلايی و مغلزاسللتخوان، در رتبللههللای بعللدی قللرار گرفتنللد )نمللودار 1(.
سلولهای مغز اسلتخوان بيشلترين ميلزان بيلانoct4 را کلهمهمترين مارکر سلولهای بنيادی جنينل ی مل یباشلد ، از خلودنشان داد )10/1P<( )نمودار 4(. پس از آن، سلولهای اليلاي ی و سلولهای رربی، بدون اختلاف معنلادار نسلبت بله هلم ، در ردههای بعدی قلرار گرفتنلد . بيلان ژن 2-sox در سللول هلای بنيادی مزانشيمی مغز استخوان، بليش از دو گلروه ديگلر بلود)10/1P<( )نمودار 0(.
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

41

*

*

نمودار 2. مقایسه بيان ژن klf4 در سلولهتا ی بنيتاد ی القتای ي و سلولهای بنيادی مشتق از مغز استخوان و چربي. ميزان بيان این ژن در سلولهای بنيادی مغز استخوان )MS( به طور معنت يداری کمتر از دو گروه دیگر است. *20/2P<.

*

*

نمودار 4. مقایسه بيان ژن oct4 در سلولهتا ی بنيتاد ی القتای ي و سلولهای بنيادی مشتق از مغز استخوان و چربي. ميزان بيان این ژن در سلولهای بنيادی مغز استخوان به طور معنيداری بيش از دو گروه دیگر است.*20/2P<.

الف ب ج

شکل 1. الف: تصاویر ميکروسکوپ فازکنتراست از سلولهای بنيادی مشتق از چربي در پاساژ 7 و ب: کشت اوليهی سلولهای تتك هستته ای مغتز استتخوان 7.
بزرگنمایي ×222. ج: کلني سلولهای بنيادی القایي، بزرگنمایي×122.

*



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید