پژوهنده )مجله پژوهشي دانشگاه علوم پزشکي شهيد بهشتي(
تاريخ دريافت مقاله: 6/8/3192
سال هجدهم، شماره بهمن6 ، و پي در اسفند پي 359699، صفحات 503 تا 509 تاريخ پذيرش مقاله: 31/32/3192
بررسي ارتباط پليمورفيسم ژن مهارکنندهی فعال کنندهی پلاسمينوژن-3
)1-PAI( با سقط مکرر جنين
فاطمه شاکرمي*3، دکتر محمد تقي اکبری5,9، دکتر شهره زارع کاريزی4

3. دانشجوی کارشناسی ارشد ژنتیک، گروه زیست شناسی ،دانشگاه گیلان، رشت
2. عضو هیأت علمی گروه ژنتیک پزشکی، دانشگاه تربیت مدرس، تهران
1. آزمایشگاه ژنتیک پزشکی تهران- دکتر اکبری، خیابان طالقانی، پلاک253
-10921208755

4. استادیار ژنتیک مولکولی، گروه زیست شناسی، دانشگاه آزاد اسلامی، واحد پیشوا، ورامین چکيده
سابقه و هدف: منظور از سقط تکراری، وقوع 2 یا 1 بار سقط متوالی خود به خودی ،قبل از هفته 21 میباشد. با توجه به شیوع حدود 5% سقط در زنان، اثرات مخرب روانی سقط بر زندگی خانوادگی افراد و اینکه علت بخشی از این سقطهاا مشاکلات اناقاادی اسات، دراین مطالاه، پلیمورفیسم ژن مهارکنندهی فاالکنندهی پلاسمین-3 1(-(PAI مورد بررسی قرار گرفت و ارتباط آن با ساقط خاود باهخودی در بیماران ایرانی و گروه کنترل سالم مورد ارزیابی قرار گرفت.
مواد و روشها: در این مطالاهی مورد-شاهدی، 311 بیمار با سابقهی سقط )حداقل دو بار( به عنوان گروه بیماار و 311 زن ساالم بااحداقل دو زایمان موفق و بدون سابقهی سقط به عنوان گروه کنترل، مورد مطالاه قرار گرفتناد. اساتخرا DNA از لوکوسایت هاا و بااروش نمک اشباع، انجام شد. برای بررسی پلیمورفیسمهای PAI-1 (4G/5G) واکنش زنجیرهی پلیمراز انجام و حضور یا عادم حضاورموتاسیون PAI-1 (4G/5G) توسط روش PCR-RFLP بررسی شد .به منظور تجزیه و تحلیل آماری از نرم افزار SPSS ویرایش 38 و از آزمون مربع کای استفاده و ارزش احتمال 15/1P< به عنوان سطح مانیداری در نظر گرفته شد.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

يافتهها: در مطالاهی حاضر، برای بررسی پلیمورفیسم PAI-1 (4G/5G)، فراوانی آلل موتانت 4G در زنان دچار ساقط مکارر، 42% و در زنان گروه شاهد، 11% به دست آمد، که نشاندهندهی افزایش مانیدار) 132/1P=( الل 4G در جمایات بیماار نسابت باه گاروه کنترل بود )میزان خطر نسبی در جمایت: 81/3(. نتایج در مورد ژنوتیپ 4G/4G با فراوانی 31% در گروه بیمار ،5% در گاروه شااهد و 116/1P= )میزان خطر نسبی: 61/4( نیز نشاندهندهی افزایش مانیدار ژنوتیپ 4G/4G در گروه بیماران بود.
نتيجهگيری: با توجه به نتایج حاصل به نظر میرسد خانمهای دارای سقط مکرر، در مواجههی بیشاتر باا الال4G و ژنوتیاپ4G/4G هستند. از این رو، بررسی وجود این جهش همراه با سایر عوامل مشکوک مثل MTHFR، فاکتور 5 لایدن در بیماران مباتلا باه ساقطمکرر، توصیه میشود.

-18287230508

واژگان کليدی: سندرم سقط مکرر جنین، ترومبوفیلیا، مهارکنندهی فاالکنندهی پلاسمین-3، PCR-RFLP لطفاً به این مقاله به صورت زیر استناد نمایید:
Shakarami F, Akbari MT, Zare Karizi S. Association of plasminogen activator inhibitor-1 (PAI-1) polymorphisms with recurrent pregnancy loss. Pejouhandeh 2014;18(6):305-309.
5085369

مقدمه3
سقط، یکی از شایعترین عوارض حاملگی است و به مواردی اطلاق میگردد که تا قبل از هفتهی 21 حااملگی باه دلایال مختلف مادری و جنینی، حاملگی خاتمه مای یاباد و منظاور از

*نويسنده مسؤول مکاتبات: فاطمه شاکرمي؛ گاروه زیسات شناسای، دانشاگاهگیلان، رشت ،تلفان هماراه: 19322161529، فکا : 1169136-1443؛ پستتالکترونيك: [email protected]
سقط تکراری وقوع 2 یا 1 بار سقط متاوالی خاود باه خاودی،قبل از هفتهی بیستم میباشد )3 و 2(. پنجاه درصاد از ماوارد سقط تکراری شاامل علال آناتومیاک ، ایمونولوژیاک ، ژنتیاک ، آندوکرین، ترومبوفیلیک و فاکتورهای محیطی میباشد. با ایانحال، در 51 درصد موارد، علت سقط نامشاخ اسات )1(. از آنجا که بیش از نیمای از ماوارد ساقطهاای تکاراری باا علاتنامشخ با اختلالات ترومبوفیلی در ارتباط میباشاند ، آناالیزپل یمورفیس م ژنه ای م دثر در ترومب وفیلی بای د در م وارد مختلفی مورد مطالاه قرار گیرد.
مهارکنندهی فاال کنندهی پلاسامینوژن -3 باه عناوان یاک گلیکوپروتئین )با وزن مولکولی 51 کیلو دالتون( نقاش بسایارمهم ی در ممانا ت از واک نشه ای فیبرین ولیز دارد. تب دیل پلاسمینوژن به پلاسمین باه عناوان مرحلاهای مهام در رونادانحاالال لختااه بااوده و توسااط فاااال کنناادههااایی نظیاارفاالکنندههای پلاسمینوژن بافتی )t-PA( و فاالکنناده هاایپلاسا مینوژن یوروکینا از )u-PA( تنظا یم ما یشا ود )4(. مهارکنناادهی فاااالکنناادهی پلاساامینوژن-3، سااریعتاارین مهارکنندهی t-PA باوده و میازان تشاکیل لختاه در سیساتماناقادی را تنظیم میکناد . اخیاراًاخیارا نشاان داده شاده اسات کاهغلظاات پلاساامایی و جفتاای مهااار کنناادهی فاااالکنناادهی پلاسمینوژن-3 در زنان با سابقهی پره اکلامپسی در مقایسه با زنان ساالم و باارور، زیاادتر باوده و افازایش ساطح پلاساماییمهارکنندهی فاالکنندهی پلاسامینوژن -3 منجار باه کااهشفاالیت فیبرینولیز میشود )4(.
ژن مهارکنندهی فاالکنناده ی پلاسامینوژن -3 از 9 اگازونساخته شاده و در حادود 32 کیلاو بااز طاول دارد و بار روی کروموزوم شماره 1 در موقایت q21.3-q22 قرار گرفته اسات.
پل یمورفیس م ش ایع در منطق هی پروم وتری ژن 1-PAI ب ه وضوح با تغییر سطح آن همراه است. این پلای مورفیسام ، یاکتغییر در میان پنج گوانوزین متوالی در ناحیه bp 615 قبال ازسایت رونویسی و تبدیل آن به 4 گواناوزین باوده و منجار باهافزایش تولید 1-PAI در پاسخ به محرکهای مختلف میشاود )1(.
به طور طبیای، بیان ژن 1-PAI توسط آلل 5G/5G صورت میگیرد. هموزیگوت بودن الل 4G در ژن 1-PAI در منطقهی پروموتر باا افازایش رونویسای از ژن هماراه باوده و منجار باهافزایش بیان ژن میشود. مقدار باالای 1-PAI تولیاد شاده دراثر الل 4G میتواند سبب افزایش تولید لخته شود، چرا که در سیستم فیبرینولیز و اناقاد، اختلال ایجاد شده و میتواند باعث ترومبوز مکرر و پیر شدن زودرس جفت شود )1(.
مطالاات زیادی به بررسی ارتباط پلیمورفیسم ژن 1-PAI با سقط مکرر جنین در جمایتهای مختلف غیر ایرانی و ایرانای )به طور محدود(، پرداخته و نتایج متناقضای از ایان مطالااات حاصل شده است. به همین دلیل، بررسی این پلیمورفیسمهاا بار دیگر پیشنهاد میشود تا در صورت شیوع بالای آن در ایان منطقه، از آن به عنوان نشاانگر تشخیصای در خاانم هاایی کاه دارای سقط مکرر جنین میباشند، استفاده شود.
116/ دوماهنامه پژوهنده بررسی ارتباط پلیمورفیسم ژن 1-PAI با سقط مکرر جنین
مواد و روشها
در این مطالاهی مورد-شاهدی ،311 بیمار با سابقهی حاداقل دو سقط خودبخودی به عنوان گروه نمونه و 311 خاانم دارایح داقل 2 تول د موف ق و ب دون ه یر تاریخ اهای از س قط ،اندومتریوز و یا ناباوری به عنوان گروه شاهد، مورد مطالاه قارارگرفتند. بیماران گاروه نموناه، ابتادا از بابات عوامال شاناخته شدهی دخیل در سقط مکرر جنین مانناد عوامال آنااتومیکی ، عوامل ایمونولوژیک، عوامل عفونی، عوامل مارتبط باا سیساتم اندوکرینی و کاریوتیپ، مورد بررسی قرارگرفته و در تمام موارد سنجیده شده، نرمال بودند. محدوده سان ی گاروه بیماار ، باین 45-21 سال و تاداد سقطهای مکرر این گروه ،بین 6-2 مورد بود. هم نین، محدوده سنی گروه شاهد باین 51-22 ساال و تاداد بارداریهای موفق این گروه باین 6-2 ماورد باود . افاراد شرکت کننده در گروه بیمار، از میان افراد مبتلا به سقط مکرر جنین که به آزمایشگاه ژنتیک پزشکی تهاران )دکتار اکباری ( مراجاه داشتند، انتخاب شدند. هم نین، از تماام افاراد ماورد مطالاه پ از دادن آگاهی، رضایتنامه دریافت شد.
تعيين ژنوتيپ: در این تحقیق از کلیهی افراد مورد مطالاه 5 میلیلیتار خاون محیطای در لولاه هاای حااویEDTA اخا گردید. استخرا DNA ژنومی به روش نمک اشباع انجام شد .پ از آن تکثی ر قطا هی ژن ی م ورد نظ ر توس ط واک نش زنجیرهای پلیمراز (PCR) و پرایمرهای اختصاصی، مساتقیم – ماکوس F-5′CACAGAGAGAGTCTGGACACGTGA3′
R-5′TGCAGCCAGCCACGTGATTGTCTAG3 انجاا ام گرفت) 6(. واکنش PCR در حجام 25 میکرولیتار حااوی 81 ناانوگرمDNA ژنومیاک ، 1 میکرولیتار10X PCR Buffer ، 25/1 میلیمولار از هر dNTPs، 5/3 میلیمولار 2MgCl، 5 تا
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

1 پیکوم ول از ه ر پرایم ر و 5/1 واحاد آن زیم Taq DNA polymerase )سیناژن، ایران( صاورت گرفات. تکثیار در 11 سیکل، دمای 95 درجه ساانتی گاراد باه مادت 51 ثانیاه ، 69 درجه سانتیگراد 51 ثانیه و 12 درجه سانتیگراد به مدت 51 ثانیه انجام شد. دناتوراسیون اولیاه باه مادت 5 دقیقاه در 95 درجه سانتیگراد و طویلسازی نهایی باه مادت 31 دقیقاه دردمای 12 درجه ساانتی گاراد صاورت گرفات. محصاول اصالیPCR ژن 1-PAI که bp 348 طول دارد، محلای بارای بارشآنزیم محدود کنندهی BseRI ندارد، ولی تغییر در میاان پانجگوان وزین مت والی در ناحی هی پروم وتری و تب دیل آن ب ه 4 گوانوزین، باعث ایجاد جایگاه برش شده و آنازیم مای تواناد دو قطاه) bp 18 و bp 331( ایجاد کند. محصولات PCR پ از هض م آنزیم ی توس ط آن زیم (Biolabs, New ،Bse RIتحليل آماری: مشاهدات وارد نرم افازار SPSS )نگاارش 38( شد. توزیع ژنوتیپهای هر موتاسیون، فرکاان هوموزیگاوت وهتروزیگوت در دو گروه بیمار و شاهد با استفاده از مرباع کاایمورد سنجش قرار گرفت .P-value کمتار از 15/1 باه عناوانس طح مان یداری در نظ ر گرفت ه ش د. بن ابراین P-value و نسبت خطر )Odds Ratio( برای هر گروه محاسبه گردید.

يافتهها
در ای ن تحقی ق، پل ی مورفیس م ژن PAI-1 (4G/5G) در
شماره 6، پیدرپی 96، بهمن و اسفند 3192 فاطمه شاکرمی و همکاران/ 111England)، روی ژل آکری ل آمی د 32% ب رده ش د و پ از رن آمی زی ب ا نیت رات نق ره نت ایج حاص له آن الیز گردی د .

شکل 3. نتايج حاصل از الکتروفورز هضم آنزيمي ژن 1-PAI بر روی ژل پليآکريلآميد. چاهك 3: مارکر اندازهگيری DNA، چاهك 9: هموزيگوت 5G/5G، چاهتك5: هتروزيگوت 4G/5G، چاهك 4: هموزيگوت.

311 خانم که حداقل 2 تولد موفق داشتند و 311 خانم مباتلابه سقط مکرر، با استفاده از روش PCR-RFLP مورد بررسایقرار گرفت. نتایج حاصل از فراوانی اللی و ژنوتیپی بارای چنادشکلی ژن 1-PAI در جدول 3، آورده شده است. لازم به ذکاراست که فراوانی ژناوتیپی مشااهده شاده در گاروههاای ماوردمطالاه، از تاادل هاردی-واینبرگ تبایت میکند. با توجاه باهنتایج مشاهده شده در الکتروفورز محصول RFLP، ژنوتیپ هر فرد برای پلیمورفیسم 4G/5G ژن 1-PAI مشخ شد.
در مطالاهی حاضر، فراوانای آلال موتانات4G در زناان دچاارسقط مکرر، 42 درصد و در زنان گروه شااهد ، 11 درصاد باود که نشان میدهد الل 4G در جمایت بیماار نسابت باه گاروه کنترل، افازایش مانای داری )132/1P=( دارد و میازان خطارنسبی برای آن در جمایت، تقریباتقریباً 81/3 میباشد. این نتایج در مورد ژنوتیپ 4G/4G با فراوانی 31 درصد در گروه بیماار و 5 درصد در گروه شاهد ،116/1P= و میازان خطار نسابی 61/4 نیز صدق میکند.

جدول 3. فراواني ژنوتيپي ،اللي و بررسي سطح معنيداری برای پليمورفيسم PAI-1(4G/5G) در گروه مورد و شاهد.
P-value OR (95% CI) بیمار )%( شاهد )%( فراوانی اللی در کل افراد مطالاه شده
– 3 336)%58( 341)%11( 5G
1/1321 3/69 )3/33-2/55( 84)%42( 61)%11( 4G
P-value OR (95% CI) بیمار )%( شاهد )%( فراوانی ژنوتیپ در کل افراد مطالاه شده
– 3 11)%11( 45)%45( 5G/5G
1/1 3/16 )1/15-2/41( 51)%51( 51)%51( 5G/4G
1/116 4/61 )3/55-31/84( 31)%31( 5)%5( 4G/4G

118/ دوماهنامه پژوهنده بررسی ارتباط پلیمورفیسم ژن 1-PAI با سقط مکرر جنین
بحث
فا ال کنن دهی مهارکنن دهی پلاس مینوژن-3، ی ک س رین پروتئاز است که بخشی از آبشار آنزیم تبدیل پلاسامینوژن باهپلاسمین را تشکیل میدهد. به نظر میرسد ،u-PA، گیرندهی u-PA و 1-PAI، پروتئااولیز و بازسااازی بافاات مااادر را طاایتهاجم تروفبوبلاستی بر عهده دارند. در بارداریهای موفق، این سیس تم ش دیداًدیدا ب رای ایج اد تا ادل مناس ب ب ین تش کیلماتریک خار سلولی و فیبرین، تحت کنترل و تنظیم اسات.به علاوه، لختاه هاای خاونی درون وریادی و افازایش فیبارینفضای بین پرزهای جفات ، از جملاه یافتاههاای مورفولوژیاکرایجی در بافتهای سقط خود به خودی هستند که اختلال در هموس تاز را نش ان م یدهن د )9(. از ای ن رو، بررس ی چن د شکلیهای ژن 1-PAI در زنان مباتلا باه ساقط مکارر بادونعلت، امکان کشف ارتباط این چندشکلیها باا ساقط مکارر رافراهم میسازد.
در مطالاهی حاضر، فراوانی الل موتانات4G در زناان دچاارسقط مکرر، 42 درصد و در زنان گروه شااهد ، 11 درصاد باودکه نشان میدهد الل 4G در جمایت بیماار نسابت باه گاروه کنت رل، اف زایش مان یداری )132/1P=( دارد .ای ن ارتب اط مانیدار در ماورد ژنوتیاپ 4G/4G باا 116/1P= نیاز صادق
ماایکنااد. نتااایج حاصاال مبناای باار ارتباااط ماناایدار بااین پل یمورفیس م 4G/4G ژن 1-PAI و س قط مک رر توس ط دو مطالاهی قبلی انجام شده در ایران نیز تأیید میشوند. ایان دومطالاه، شامل مطالاهی انجام گرفته توساط سالطان قرایای وهمکاران در سال 2111 و مطالاهی انجام گرفته توسط اعرابی و همکاران در سال 2133 میباشند )31(. این ارتباط مانیدار در مطالاهی Goodman و همکاران )آمریکا، 2119(، Guanو همکاران )چین، 2115(، Al Sallout و همکاران )نوار غازه ،
2133( نیز مشاهده شده است )31 و 34(.
در مقابل، مطالاات دیگاری از جملاه مطالااات انجاام شاده
توسط Dossenbach-Glaning و همکاران) 2111، اتاریش(، Ivanov و همکاران) 2133، بلغارستان( و دو مطالاهی انجاامگرفتاه توس ط Coulam و همک اران در س الهاای 2116 و 2118 در آمریکا میباشند که ارتباط مانیداری باین ژنوتیاپ
4G/4G با سقط مکرر جنین نشان نمیدهند )35(.
در واقع در مطالاات انجام شده در ارتبااط باا پلایمورفیسام PAI-1 4G/5G و سقط مکرر، حتی در مطالاات انجام گرفتاه در یک کشور نیز تناقضاتی در نتایج یافت مای شاود. مثاالی ازاین تناقضات، مطالاهی Wolf و همکاران در آلمان اسات کاه ارتباط بین عوامل دخیل در هیپوفیبرینولیز را با ساقط مکارر، مورد بررسی قرار داده و در سال 2111 گزارش کردند کاه 53 درصد از زنان دچاار ساقط مکارر و 49 درصاد از زناان گاروهکنترل برای موتاسیون 4G در ژن 1-PAI، هتروزیگاوت و 15 درصد از زنان دچاار ساقط مکارر و 13 درصاد از زناان گاروهکنترل برای این موتاسیون، هموزیگوت هستند. با توجه به این نتایج، ارتباط مانااداری میاان پلایمورفیسام4G/5G در ژن
1-PAI و سقط مکرر گزارش نکردند )33(.
ب ا ای ن ح ال، در مطالا هی دیگ ری ک ه در س ال 2118، Schenk و همکاران در آلمان انجام دادند، گزارش کردناد کاهدر مقایسه باا گاروه کنتارل، فراوانای الالهاای4G )ژنوتیاپ4G/4G یا 4G/5G( در گروه بیمار، به طاور مانااداری باالاتربود )32(. این امر احتمالاًاحتمالا مربوط به تفااوت در جمایات ماوردمطالاه، زمینههای ژنتیکی، تاداد گاروه ماورد مطالااه، راناشژنی، مهاجرت جمایتها یا انتخاب طبیای است .
به همین منظور، جهات بررسای دقیا قتار ایان فاکتورهاا و ارتباط آن با سقط مکارر جناین ، در مطالااات آتای پیشانهاد میشود که نمونههای انتخابی حتی المقدور از مناطق مشابهی انتخاب گردند و یا اینکه پ زمینهی ژنتیکی نمونههای شاهد و بیمار با هم مشابهت داشته باشد. عوامل محیطی خطار سااز شناخته شده برای ساقط مکارر ، مانناد اساتفاده از دخانیاات،
BMI در پرسش نامهی بیماار لح ا گاردد و ریس ک آن ب ا بیماری نیز محاسبه گردد.

نتيجهگيری
عملکردهاا ای بیولوژیاا ک 1-PAI در تنظاا یم فاالیاا ت فیبرینولیتیک در تشکیل جفت و تهاجم تروفوبلاست در دوران بارداری انسان مهم هستند. نتایج حاصل از مطالاهی حاضر نیز وجود الل 4G و ژنوتیپ 4G/4G را به عنوان فااکتور مادثر در سقط نشان میدهد.
با توجه به نتایج مطالاهی حاضر و مطالااات پیشاین انجاامگرفته در ایران بر روی ارتباط این فاکتور و سقط مکرر جناینو پاتوژنز ارتباط این فاکتور با ساقط مکارر ، فرضایه ی مارتبط بودن این فااکتور باا ساندرم ساقط مکارر در جمایات ایاران کماکان پا برجاست. به همین منظور جهت بررسی دقیقتر این فاکتور و ارتباط آن با سقط مکرر جنین، انجام مطالاات بیشتر و مطالاهی COHORT )همگروهی( پیشنهاد میشود.

تشکر و قدرداني
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

این پروژه با حمایت مالی آزمایشگاه ژنتیاک پزشاکی تهارانانجام شاد. نویساندگان مقالاه از زحماات فاراوان کارشناساان
شماره 6، پیدرپی 96، بهمن و اسفند 3192 فاطمه شاکرمی و همکاران/ 119محترم آزمایشگاه ژنتیک پزشکی تهاران- دکتار اکباری بارای مینمایند. لازم به ذکار اسات رضاایتناماه ی کتبای از بیماار،همک اری ص میمانه در اج رای ای ن ط رح، تش کر و ق دردانی مبنی بر انتشار این مقاله اخ شده است.

REFERENCES

Tulandi T, Al-Fozan HM. Definition and etiology of recurrent pregnancy loss. 2011; Available from: http:// www.uptodate.com/contents/definition-and-etiology-of-recurrent-pregnancy-loss.
Christiansen OB, Nielsen HS, Kolte A, Pedersen AT. Research methodology and epidemiology of relevance in recurrent pregnancy loss. Semin Reprod Med 2006;24(1):5–16.
Franssen MT, Korevaar JC, Leschot NJ, Bossuyt PM, Knegt AC, Gerssen-Schoorl KB. Selective chromosome analysis in couples with two or more miscarriages: case-control study. BMJ 2005;331(7509):137–41.
Kuhli C, Luchtenberg M, Scharrer I, Hattenbach LO. Massive subhyaloidal hemorrhage associated with severe PAI-1 deficiency. Graefes Arch Clin Exp Ophthalmol 2005;243:963–6.
Yepes M, Loskutoff DJ, Lawrence DA. Plasminogen activator inhibitor-1. In: Coleman RW, Marder VJ, Clowes AW, George JN, Goldhaber SZ, eds. Hemostasis and Thrombosis: Basic Principles and Clinical Practice. Philadelphia, PA: Lippincott Williams and Wilkins; 2006. p. 365–80.
Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res1988;16(3):1215–20.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:08 +0330 on Wednesday January 10th 2018

Festa A, D’Agostino RJr, Rich SS, Jenny NS, Tracy RP, Haffner SM. Promoter (4G/5G) plasminogen activator inhibitor-1 genotype and plasminogen activator-1 levels in blacks, Hispanics and non Hispanic whites: the Insulin Resistance Atherosclerosis Study. Circulation 2003;20:2422–7.
Buchholz T, Lohse P, Rogenhofer N, Kosian E, Pihusch R, Thaler CJ. Polymorphisms in the ACE and PAI-1 genes are associated with recurrent spontaneous miscarriages. Hum Reprod 2003;18:2473–7.
Dossenbach-Glaninger A, van Trotsenburg M, Dossenbach M, Oberkanins C, Moritz A, Krugluger W, et al. Plasminogen activator inhibitor-1 4G/5G polymorphism and coagulation factor XIII Val34Leu polymorphism: impaired fibrinolysis and early pregnancy loss. Clin Chem 2003;49(7):1081–6.
Aarabi M, Memariani T, Arefi S, Aarabi M, Hantoosh Zadeh S, Akhondi MA, et al. Polymorphisms of plasminogen activator inhibitor-1, angiotensin converting enzyme and coagulation factor XIII genes in patients with recurrent spontaneous abortion. J Matern Fetal Neonatal Med 2011;24:545–.8
Wolf CE, Haubelt H, Pauer HU, Hinney B, Krome-Cesar C, Legler TJ, et al. Recurrent pregnancy loss and its relation to FV Leiden, FII G20210A and polymorphisms of plasminogen activator and plasminogen activator inhibitor. Pathophysiol Haemost Thromb 2003;33(3):134–.7
Schenk JF, Stephan B, Zewinger S, Speer T, Pindur G. Comparison of the plasminogen activator inhibitor-1 4G/5G gene polymorphism in females with venous thromboembolism during pregnancy or spontaneous abortion. Clin Hemorheol Microcirc 2008;39(1–4): 329–.23
Goodman C, Hur J, Goodman CS, Jeyendran RS, Coulam C. Are polymorphisms in the ACE and PAI-1 genes associated with recurrent spontaneous miscarriages? Am J Reprod Immunol 2009;62:365–.07
Al Sallout RJ, Sharif FA. Polymorphisms in NOS3, ACE and PAI-1 genes and risk of spontaneous recurrent miscarriage in the Gaza Strip. Med Princ Pract 2010;19:99–.401
Su MT, Lin SH, Chen YC, Kuo PL. Genetic association studies of ACE and PAI-1 genes in women with recurrent pregnancy loss: a systematic review and meta-analysis. Thromb Haemost 2012;109(1):8–.51



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید