پژوهنده (مجله پژوهشي دانشگاه علوم پزشكي شهيد بهشتي)
تاريخ دريافت مقاله: 12/6/1391 سال هفدهم، شماره مرداد3 ، و پي در شهريور پي 139187، صفحات 152 تا 156 تاريخ پذيرش مقاله: 6/9/1391
جداسازي و تعيين سروتيپ O:3 يرسينيا انتروكوليتيكا
از گوشت مرغ عرضه شده به بازار مصرف شهرستان شهركرد
شيرين صابريان پور1*، الهه تاجبخش2، منير دودي3

دانش آموخته كارشناسي ارشد ميكروبيولوژي، دانشگاه آزاد اسلامي، واحد فلاورجان
استاديار، گروه ميكروبيولوژي، دانشگاه آزاد اسلامي، واحد شهركرد
-10921186483

استاديار، گروه ميكروبيولوژي، دانشگاه آزاد اسلامي، واحد فلاورجان چكيده
سابقه و هدف: يرسينيا انتروكوليتيكا يك باكتري گرم منفي و پاتوژن رودهاي است كه از طريق آب و مـواد غـذايي بـه انسـان منتقـلشده و اغلب اپيدمي هاي آن به دنبال مصرف مواد غذايي آلوده، به ويژه گوشتهاي آلوده نظير گوشت مرغ ايجاد مـي شـود. هـدف از ايـنمطالعه جداسازي و تعيين ميزان شيوع سروتيپ O:3 يرسينيا انتروكوليتيكا در گوشت مـرغ عرضـه شـده بـه بـازار مصـرف شهرسـتانشهركرد مي باشد.
مواد و روشها: در اين تحقيق 300 نمونه گوشت مرغ از فروشگاههاي عرضـه گوشـت مـرغ در سـطح شهرسـتان شـهركرد بـه صـورتتصادفي جمع آوري شد و در شرايط استريل به آزمايشگاه ميكروبيولـوژي دانشـگاه آزاد اسـلامي واحـد شـهركرد منتقـل گرديـد. روش جداسازي بر اساس غني سازي اوليه در فسفات بافر سالين به مدت 2 هفته در يخچال و سپس استفاده از KOH به عنـوان غنـي سـازيثانويه و كشت در محيط CIN agar انجام گرديد. جهت شناسايي سروتيپ O:3 يرسينيا انتروكوليتيكا نمونه هاي مثبـت بـه روشPCR در حضور پرايمر اختصاصي ژن rfbC مورد آزمايش واقع شدند.
يافته ها: از مجموع 300 نمونه گوشت مرغ مورد بررسي، 65 نمونه به روش كشت و روش مولكـولي مثبـت تشـخيص داده شـدند كـهميزان آلودگي 66/21% برآورد گرديد. 10 مورد (38/15%) از باكتري هاي جداسازي شده جزو سروتيپ O:3 قرار گرفتند.
نتيجه گيري: با توجه به نتايج به دست آمده كه حاكي از حضور يرسينيا انتروكوليتيكا در گوشت مرغ مي باشد و نيـز از آنجـايي كـهاين باكتري به راحتي از طريق غذا قابل انتقال بوده و به راحتي در دماي 4 درجه سلسيوس يخچال رشد مي كند، لذا توصيه مي شـو د كه مسؤولين بهداشتي كشور توجه خاصي به اين مسأله مبذول داشته تا از خطرات بهداشتي و اقتصادي آن جلوگيري به عمل آيد.

6109235497

واژگان كليدي: يرسينيا انتروكوليتيكا، آلودگي مواد غذايي، مرغ، شهركرد، ايران لطفاً به اين مقاله به صورت زير استناد نماييد:
Saberianpour Sh, Tajbakhsh E, Doudi M. Prevalence of Yersinia enterocolitica serotype O:3 isolated from chicken meat
511165584

in Shahrekord, Iran Pejouhandeh 2012;17(3):152-6.

0مقدمهF1
يرسينيا يكي از باكتري هاي بيماريزاي سرماگرا مي باشد. ايـ ن باكتري در دامنه حرارتي 45-2 درجه سلسيوس رشد مي كند .
گونه انتروكوليتيكاي اين باكتري در اغلب كشورها وجود داشته و از نيمه دوم دهه هفتاد، به دفعات از اختلالات گوارشي انسان جدا شده است (1). باكتري يرسينيا زئونـوز بـوده و يرسـينيوزي ك بيم اري مش ترك ب ين انس ان و دام اس ت. يرس ينيا در

*نويسنده مسؤول مكاتبات: شيرين صابريان پور؛ اصفهان، فلاورجـان ، خي ابـان
دانشـ گاه، دانشـ گاه آزاد اسـ لامي واحـ د فلاورجـ ان؛ پسـ ت الكترونيـ ك:
[email protected]

طبيعت توسط مواد غذايي از قبيل لبنيات و گوشـت حيوانـاتآلوده به خصوص خوك، گاو، گوسـفند، بـز و طيـور بـه انسـانمنتقل مي شود، لذا اين باكتري به عنوان Food borne شناخته مي شود(2). انتروكوليت حاصل از يرسينيا انتروكوليتيكا بوسيله علائمي مانند اسهال و درد شكم مشخص مي شـود. اسـهال بـهمدت 14-7 روز ادامه داشته و اسهال ناشي از ايـ ن بـاكتر ي در ماههاي سرد، افـراد مـذكر و جوانـان شـايعتر اسـت (3). ايـ ن باكتري قـادر بـه ايجـاد لنفادنيـ ت، سـلول يت و عفونـت زخـم، فارنژيــت، ســپتي ســمي و مننژيــت، انــدوكارديت، پنومــوني، آبس ه ه اي متمرك ز دركب د و طح ال و اس تئوميليت اس ت. واكنش هاي ثانوي ه مانن د اريتم ا ن ودوزوم، گلومرولونفري ت و آرتريت نيز احتمالاً توسط ايـ ن بـاكتر ي ايجـاد مـ ي شـود (3). ميــزان جداســازي ايــن ارگانيســم بــا اســتفاده از روشــ هاي به كارگيري سرما (Cold enrichment) و با استفاده از KOH به شدت افزايش مي يابـد (4). يرسـ ينيا انتروكوليتيكـا بـر اسـاستنوع آنتي ژني در ديواره سلولي ليپوپلي ساكاريدي خود به بيش از 50 سروتيپ مختلف تقسيم مي شود. سويه هايي با سـروت يپ O:3 ،O:27 ،O:5 وO:9 عوامل عمده بيماريزاي انسانها دراروپا، ژاپن، آفريقاي جنوبي و كانادا مي باشند( 5). گوشت مـرغ غ يـ ر بهداشتي از منابع عمده انتقال عفونت يرسينيا انتروكوليتيكا به انس ان اس ت. ب ه دلي ل اهمي ت ف وق الع اده گوش ت م رغ از نظراقتصـ ادي و تغذيـ ه اي، مطالعـ ات گسـ ترده اي بـ ر روي آلودگيهاي ميكروبي و بيماريهاي منتقلـه از طر يـ ق گوشـت دركشورهاي مختلف انجام شده است. از آنجايي كه تغذيـ ه سـالماز اركان اصلي سلامتي و بهداشتي مـردم محسـوب مـي شـود ، اميد است با بررسي فراواني اين باكتري در گوشت مرغ و انجام اقدامات لازم جهت شناسايي منابع آلودگي بتوان ابتلا بـه ايـ ن عفونت را كنترل نمود.

مواد و روشها
در اين تحقيق به منظور جستجوي يرسينيا انتروكوليتيكـ ا در گوشت مرغ عرضه شده در سطح شهرستان شهركرد، از بهمـن1390 تا خرداد 1391، از چهار منطقه شمال، جنوب، شـرق وغرب شهرستان شـهركرد ، نمونـه گيـري خوشـه اي – تصـادفيانجام گرفت و 300 نمونه ران مرغ جهت تحقيق تهيه گرديـد.نمونه ها در شرايط اسـتريل و در مجـاورت يـخ بـه آزمايشـگاهميكروبيولـوژي دانشـگاه آزاد اسـلامي واحـد شـهركرد منتقـلش دند. جه ت تش خيص ميكروب ي يرسينيا انتروكوليتيكا از گوشت مرغ ،25 گرم نمونه گوشت مـرغ كـه بـا بيسـتوري درشرايط كاملاً استريل به لايه هاي بسيار نازك بريده شـده بـود، به cc 225 فسفات بافر سـالين بـا 2/7 pH= اضـافه شـد و بـهمدت دو هفته در دماي يخچال سرماگذاري گرديد. پس از 14 روز، cc 1 از سوسپانسيون غني شده با cc 9 پتاس 25% با يك همزن برقي به مدت 30 ثانيه كاملاً مخلـوط گرديـد و سـپسيك لـوپ از ايـن مخلـوط بـر روي محـيط انتخـابي – افتراقـي
شماره 3، پي در پي 87، مرداد و شهريور 1391 شيرين صابريان پور و همكاران/ 153
CINagar (cefsulodin-Irgasan- Novobiocin)كشـت داده شد و به مدت 48 ساعت در دماي 25 درجه سلسيوس انكوبـه گردي د. پ س از اي ن م دت ب ه منظ ور بررس ي خصوص يات ميكروسكوپي و مورفولوژيكي كلني هاي خالص و مشكوك، ابتدا يك رنگ آميزي گرم به عمل آمد. سپس از كلني هـاي خالصـيكه مورفولوژي آنها باسيلي شكل و واكنش گرم آن منفي بود در محيطهاي كشت افتراقي (همانند SIMجهت بررسي حركـت ، اندول، MRVP (متيـل رد و وژپرسـكوير) ، سـيترات آگـار ، اوره ب رات، فني ل آلان ين آگ ار، آرژين ين دهي درولاز، اورنيت ين دكربوكسيلاز، محيطهاي قندي همانند گلوكز، لاكتوز، ساكاروز، مانيتول، مالتوز و گزيلوز) جهت پـي بـردن بـه توليـد اسـيد از قندهاي مذكور، استفاده گرديد .در نهايت نتايج به دست آمـدهبا جداول تشخيص باكتري ها در كتابهاي معتبر مقايسـه شـد و شناسايي باكتري مورد نظرصورت گرفت (2).
باكتري هاي جدا شده در مرحله قبل، به مـدت يـك شـب درمحيط مايع لوريـا برتـاني(Luria berthani broth, Merck) در دماي 37 درجه سلسيوس كشـت داده شـدند و DNA ژنـوميباكتري هاي رشد يافتـه بـا اسـتفاده از كيـت اسـتخراجDNA
اسـتخراج و (DNA genomic purification kit, CinnaGen) .در دماي 20- درجه قرار گرفت
جهـت تشـخيص قطعـي يرسـيني ا انتروكوليتيكـ ا بـر روي نمونه هايي كه با روشهاي ميكروبيولوژي و بيوشيميايي مثبـت تشخيص داده شده بودند، آزمايش PCR انجام گرفت. آزمـايش PCR درحضـور زوج پرايمرهـاي طراحـي شـده در حجـم 50 ميكروليتـ ر (شـ امل 5 ميكروليتـ ر PCR buffer10x، 150 ميكرومول dNTP miX، 2 ميلي مول MgCL2 ،1 ميكرومول از هــر پرايمــر، 1 واحــد آنــزيمTaq DNA Polymerase (Fermentas) و 1 ميكروليتر از DNA مربوطه) انجام شـد . بـهتعداد نمونه هاي مورد بررسي ميكروتيوب هاي 5/0 ميلي متـري انتخاب شده و شماره گذاري شدند. يك ميكروتيوب هـم بـرايكنترل منفي شماره گذاري شد كه حاوي تمام اجزاي لازم براي PCR بود ولي به جاي DNAي الگو، از آب مقطر استفاده شـد .
سپس مـواد متشـكله واكـنشPCR در ميكروتيـو ب اسـتريلمخصوص مخلوط و در ترموسـايكلر داراي برنامـه حرارتـي 94 درجه به مدت 5 ثانيه ،30 سيكل تكراري حرارتي 95 درجه 1 دقيقه ،57 درجه 50 ثانيه و 72 درجه 6 دقيقـه قـرار گرفـت.
مشاهده باند 361 جفـت بـازي نشـاندهنده مثبـت بـودن ايـنآزمايش بود.
Y.ent: 5′- ACCTTTGTGATTGACGTTACTCGC -3′
Y.ent: 5′- CAAGTCGACATCGTTTACAGCG -3′
Accesion No: FN561632 آزمــايشPCR جهــت تشــخيص ســروتيپO:3 يرســينيا انتروكوليتيكا بـا اسـتفاده از زوج پرايمرهـايYer-R و Yer-F
(جدول 1) انجام گرفت. اين آزمايش در حجـم 50 ميكروليتـر(شامل 5 ميكروليتر PCR buffer10x، 150 ميكرومول dNTP miX، 5/1 ميلي مول MgCL2، 1 ميكرومول از هـر پرايمـر، 1

جدول شماره 1. توالي پرايمرهاي مورد استفاده جهت رديابي سروتيپ O:3 يرسينيا انتروكوليتيكا
مرجع اندازه محصول (bp) توالي پرايمر ژن
11
405
Yer O3-F:CGCATCTGGGACACTAATTCG
Yer O3-R:ACGAATTCCATCAAAACCACC rFbC

1848180-1885779تصوير شماره 1: نتايج الكتروفورز rfbC – PCR مربوط به سروتيپ O:3 باكتري يرسينيا انتروكوليتيكا بر روي ژل آگارز 1% ستون 1: ماركر 100 جفت بازي DNA. ستونهاي 2-4 : باند 405 جفت بازي متعلق به ژن rfbC، ستون 5: كنترل منفي
واحــد آنــزيمTaq DNA Polymerase (Fermentas) و 1 ميكروليتر از DNA مربوطه) و برنامـه حرارتـي 95 درجـه بـهمدت 6 دقيقـه، 30 سـيكل تكـراري 94 درجـه 60 ثانيـه، 59 درجه 70 ثانيه و 72 درجه 80 ثانيه و يك سيكل انتهـايي 72 درجه 7 دقيقه انجام گرديد.
154/ دوماهنامه پژوهنده جداسازي و تعيين سروتيپ O:3 يرسينيا انتروكوليتيكا …
يافته ها
در تحقيق حاضر بـا اسـتفاده از روشـهاي ميكروبيولـوژي ومولكولي، از مجموع 300 نمونـه گوشـت مـرغ، از 65 نمونـه(66/21%) يرسينيا انتروكوليتيكا جداسازي شـد و در حضـور پرايمر rfbC آزمايش PCR جهت تعيين سروتيپ O:3 انجـامگرف ت. از مجم وع 65 ب اكتري جداس ازي ش ده، 10 م ورد (38/15%) جزو سروتيپ O:3 طبقه بندي شدند (تصوير1).

بحث
ميكروب ها تغييرات مطلوب و نامطلوبي در مواد غذايي پديـدمي آورند. تغييرات نامطلوب سـبب آلـودگي مـواد غـذايي و در نهايت فساد مواد غذايي مي شوند. فساد عبارت است از هر نـوعتغيير در طعم، بو، بافت يا ظاهر ماده غذايي كه آن را نامطبوع و بدمزه مي كند. بسياري از مـواد غـذايي تحـت شـرايطي كـهامكان آلودگي با انواع ميكروب ها را فـراهم مـي سـازد تهيـه يـاتوليد مي شوند. رشد انواع ميكروب ها به تركيب مـاد ه غـذايي و شرايط انبار كردن بستگي دارد. ميكروب هايي كه قادر بـه رشـدهستند ويژگيهاي متابوليكي غذا را تغيير داده و طعم، بو، بافـتو ظاهر فرآورده را دگرگون مي سازند (2). فرآورده هاي حيـوانيداراي ميكروب هاي درونـي بـوده و همچنـين توسـط محـيط و انسان آلودگي پيدا مي كنند. هرگاه حيـوان بـه طـرز بهداشـتيذبح گردد بخش درونـي گوشـت آن عـاري از ميكـروب اسـت.
سطح بدن حيوان كه در معرض هوا قرار مـي گيـرد بـه وسـيله ميكروب هاي پوست و روده، وسايل كشـتن و هـواي كشـتارگاهآلوده مي گردد. گوشت مرغ نيز بـا انـواع ميكـروب هـا پوشـيده مي شود، به خصوص هنگـامي كـه آن را تميـز كـرده و بـر روي تخته آلوده خرد مي كنند. ميكروب هاي مختلفـي درون گوشـت قادر به رشد هسـتند ، يـك دسـته از ايـن بـاكتري هـايرسـينياانتروكوليتيكا مي باشد (2).
مطالعه حاضر برآوردي از شـيوعيرسـينيا انتروكوليتيكـا، در گوشت مرغ بازار مصرف شهركرد، و همچنين شـيوع سـروتيپO:3 در باكتري هاي جداسازي شده مي باشد. با توجه به اينكـهمسـ أله بهداشـت غـذايي از اهميـت ويـژه اي برخـوردار اسـت ، تحقيقات مشابهي در كشورهاي مختلف و همچنـين در ايـرانصورت گرفته است. يافته هاي ديگر محققان حاكي از آن اسـتكه يرسينيا انتروكوليتيكا شايعترين گونه يرسـينيا در گوشـتقرمز و مرغ است .در مطالعه انجام شده توسط سـلطان دلان وهمكاران در سال 2006، شيوع يرسينيا در گوشـت هاي قرمـز ومرغ عرضه شده در قصـابي ها و مـرغ فروشـيهاي تحـت نظـارتدانشگاه علوم پزشكي تهران بررسي گرديد (7). در اين مطالعـه250 نمونه گوشت مرغ و 158 نمونه گوشت قرمز طي 7 ماه از سه منطقه شهر ري، اسلامشهر و جنوب تهران بررسي شـدند .
از 250 نمونه گوشت قرمز و مـرغ مـورد بررسـي ، 111 نمونـه(44%) آلوده به يرسـينيا بود نـد كـه شـامل 46 نمونـه ( 41%) گوشت قرمز و 65 نمونه( 58%) گوشت مرغ بود (7).
همانگونه كه در قسمت نتايج بيان گرديد، در ايـن تحقيـق از مجمــوع 300 نمونــه گوشــت مــرغ ، از 65 نمونــه (66/21%) يرسينيا انتروكوليتيكا جداسازي شد. به منظـور تعيـين شـيوعسروتيپ O:3 در باكتري هاي جداسازي شده در مرحله قبل، از جفت پرايمر مربوط به ژن rfbC مطابق مطالعات قبلي استفاده گرديد. در نتيجه 10 مورد (38/15%) از باكتري هاي جداسازي شــده جــز و ســروتيپ O:3 بــاكتري يرســينيا انتروكوليتيكــ ا طبقه بندي شدند. در تحقيقي مشابه در ايران توسط مهدوي و همكاران در سال 1386 در دانشكده بهداشت و تغذيه دانشـگاهعلوم پزشكي تبريز، تعيين فراوانـييرسـيني ا انتروكوليتيكـ ا در انواع مختلف گوشت قرمز و گوشت مرغ در شـهر تبريـز انجـامگرفت. اين مطالعه نشان داد كه 3/13% از كل گوشتهاي قرمز و 8/15% ازكل گوشتهاي مرغ به باكتري يرسينيا انتروكوليتيكا آلوده بودند (8). در تحقيـق مشـابه ديگـر ي در ايـران توسـطاشرفي در سال 1388 (2)، ميزان آلودگي گوشت قرمز و مـرغعرضه شده در فروشگاههاي مواد غذايي شهرستان شميران بـهباكتري يرسينيا بررسـي شـد. در ايـن مطالعـه از 100 نمونـهگوشت قرمز و مرغ، 16 نمونه (40%) به يرسينيا انتروكوليتيكـ ا آلوده بودنـ د. مطالعـات ديگـري هـم در منطقـه چهارمحـال و بختياري به منظور جداسـازييرسـينيا انتروكوليتيكـا صـورتپذيرفته است كه از آن جمله مي تـوان بـه مطالـه انجـام شـدهتوس ط شــريف زاده و همكــاران در ســال 1380 بــه منظــور جداسازي يرسينيا انتروكوليتيكا از شير خام و پاستوريزه استان چهارمحال و بختياري اشاره كرد (1). در اين مطالعـه ، در 200 نمون ه ش ير خ ام 3% و در 200 نمون ه ش ير پاس توريزه 1% آلودگي به يرسينيا انتروكوليتيكا مشاهده شـد كـه نشـاندهندهميزان پايين آلودگي شير نسبت به گوشت، به خصوص گوشت مرغ، در ايـن منطقـه اسـت (1). مشـابه چنـين تحقيقـاتي دركشورهاي ديگر نيز صورت گرفته است .Thoerner و همكـاراندر سال 2003 در مطالعه ايي كه بر روي 140 سـويه يرسـينيا
انتروكوليتيكاي جدا شده از منـابع مختلـف انجـام دادنـد (9)، نشـان دادنـد كـه بيوتيـپ هـاي1B, 2, 3, 4 مربـوط بـه انـواعبيم اريزاي يرسينيا انتروكوليتيكاي ج دا ش ده از انس ان و
شماره 3، پي در پي 87، مرداد و شهريور 1391 شيرين صابريان پور و همكاران/ 155
حيوانات است و بيوتيپ 1A در انـواع غيـر بيمـاريزاي انسـاني
يرسينيا انتروكوليتيكا مشاهده مي شود. در ايـن تحقيـق از 53 باكتري جدا شده از حيوانات، 46 مـورد ( 87%) از خـوك جـداشده بود كه مربوط به بيوتيپ هاي بيماريزا بود .2 بيوتيپ از بز ،4 بيوتيپ از سگ و 5 بيوتيپ 1A از گاو و سگ جدا شده بـود.
تحقيقات آنها نشان داد كه سروتيپ هاي O:3 و O:9 شايعترين سروتيپ ها در انواع بيماريزاي انساني است، به طوري كه از 42 مورد يرسـينيا انتروكوليتيكـاي انسـاني ، 16 مـورد مربـوط بـهســـروتيپ O:3، 11 مـــورد O:9 و 15 مـــورد مربـــوط بـــهسروتيپ هاي ديگر بود (9).
در مطالعه ديگري كه توسط Lambertz و همكاران انجـام شـد
(10)، نشــان داده شــد كــه خوكهــا مخــزن اصــلييرســينيا انتروكوليتيكاي منتقله از غذا هسـتند . آنهـا گوشـت خـوك را ازيخچال و مغازه هاي محلي كه توسط بيماران مبتلا به يرسـينيوزخريداري شده بودند جمع آوري كردنـد و بـراي بررسـي حضـورگونه هاي يرسينيا مورد بررسي قرار دادند. از مجموع 118 نمونـهاز محصولات گوشت خوك( 91 نمونه خام و 27 نمونه آماده بـهمص رف)، در 9 م ورد از گوش تهاي خ ام خ وك (9/9%)، گون ه پــاتوژن يرســينيا شناســايي شــد و ســروتيپ O:3 يرســينيا انتروكوليتيكا در 6 مورد به روش PCR شناسـايي شـد (10). در مطالعه انجام شده توسط Niskanen و همكاران در سـال 2003 در سوئد كه بر روي 468 نمونه مـدفوع از 58 گونـه مختلـف ازپرندگان مهاجر انجام شد (11)، 8/12% از گونه هـاي يرسـينيا ازنمونه ها جداسازي شدند. بيشترين گونه يرسـينياي جـدا شـده، يرسينيا انتروكوليتيكا با 6/5% گزارش گرديد. در اين بررسي 10 نمونه يرسينيا انتروكوليتيكاي جدا شـده از غـاز داراي سـروتيپO:3 بودند كه عامل بيماريهاي انساني مي باشد( 11).

نتيجه گيري
با توجه به نتايج به دست آمده كه حاكي از حضـوريرسـينيا
انتروكوليتيكا در گوشت به خصوص گوشت مرغ مي باشد و نيز از آنجايي كه اين باكتري به راحتي از طريق غـذا قابـل انتقـال بوده و به راحتي در دمـاي 4 درجـه سلسـيوس يخچـال رشـد مي كند، لذا توصيه مي شود كه مسؤولين بهداشتي كشور توجه خاصي به اين مسأله مبذول دارنـد تـا از خطـرات بهداشـتي و اقتصادي آن جلوگيري به عمل آيد.
REFERENCES
123140583408

Sharifzadeh A, Akhavan M, Zarasvandi A, Al Agha S. Isolation of Yersinia Entrocolitica and Listeria Monocytogenes from raw and pasteurized milks supplied at dairies in Chaharmahal Bakhtiary province. Iran J Food Sci Tec 2004;1(1):15-9. (Full text in Persian)
156/ دوماهنامه پژوهنده جداسازي و تعيين سروتيپ O:3 يرسينيا انتروكوليتيكا …
Ashrafi F, Study on percentage of Yersinia contamination in red and white meat in food markets in Shemiran
Athours. J Microbiol Knowl 2009;1(2):49-52. (Full text in Persian)
Soltan-Dallal MM, Moezardalan K. Frequency of Yersinia species infection in paediatric acute diarrhoea in Tehran. East Mediterr Health J 2004;10(1-2):152-8.
de Boer E. Isolation of Yersinia enterocolitica from foods. Int J Food Microbiol 1992;17(2):75-84.
Siriken B. The presence of Yersinia enterocolitica and other Yersina species in ground beef in Aydin, Turkey. Turk J Vet Anim Sci 2004;28:489-95.
Weynants V, Jadot V, Denoel PA, Tibor A, Letesson JJ. Detection of Yersinia enterocolitica serogroup O:3 by a PCR method. J Clin Microbiol 1996;34(5):1224-7.
Soltan Dallal M.M., Izadpour F., Khalifeh Gholi M., Zeraati H., Bakhtiari R. Prevalence of Yersinia spp. in red meat and chicken marketed in southern Tehran. J Sch Pub Health Inst Public Health Res 2006;4(4):49-56 . (Full Text in
Persian)
Mahdavi S, Farshchian MR, Amini K, Abbasi M, Ghiyami Rad M, Ebadi AR. Survey of Yersinia enterocolitica contamination in distributed broiler meats in Tabriz City, Iran. Afr J Microbiol Res 2012;6(12);3019-23.
Thoerner P, Bin Kingombe CI, Bögli-Stuber K, Bissig-Choisat B, Wassenaar TM, Frey J, et al. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl Environ Microbiol 2003;69(3):1810-6.
Lambertz ST, Them MLD. Identification and Characterization of Pathogenic Yersinia enterocolitica Isolates by PCR and Pulsed-Field Gel Electrophoresis. Appl Environ Microbiol 2005;71(7):3674-81.
Niskanen T, Waldenström J, Fredriksson-Ahomaa M, Olsen B, Korkeala H. virF-positive Yersinia pseudotuberculosis and Yersinia enterocolitica found in migratory birds in Sweden. Appl Environ Microbiol 2003;69(8):4670-5.



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید