پژوهن ده (سال شانزدهممجله، شماره پژوهشي5آذر ، و پي دي در دانشگاه پي 1390 علوم83 ، پزشكي صفحات شهيد252 تا بهشتي255) تاريختاريخ پذيرشدريافت مقالهمقاله:: 2227/9//1/13901390

شيوع آلودگي پرندگان زينتي به اشرشياكلي O157:H7 در يزد در سال
حسين طهماسبيو1 2*، دكتر حسن ممتاز3، ناصر صالحي1، محمد رفيعي دولت آبادي1، فاطمه يكتنه4

دانشجوي دكتراي عمومي، دانشكده دامپزشكي، دانشگاه شهركرد
عضو پژوهشكده بيماريهاي مشترك انسان و دام، دانشگاه شهركرد، شهركرد
استاديار، گروه ميكروبيولوژي، دانشكده دامپزشكي، دانشگاه آزاد اسلامي واحد شهركرد
كارشناس، گروه پاتوبيولوژي، دانشكده دامپزشكي، دانشگاه شهركرد

چكيده
سابقه و هدف: پرندگان زينتي ميتوانند بعضي از بيماريها را در خود جاي دهند و به صاحبان خود منتقـل گرداننـد . اگرچـه مالكيـت پرندگان زينتي بدون خطر نيست، اما بسياري از خانوادههاي ايراني در منزل خود از پرندگان زينتي مراقبت مي كنند و به اين ترتيب در معرض بسياري از بيماريهاي مشترك باكتريايي، پروتوزوايي، قارچي، ويروسي يا انگلي قـرار مـي گيرنـد . اشرشـياكليO157:H7 ع امـلشيوع بيماريهاي رودهاي انساني و سندرم بالقوه مرگ بار اور مي هموليتيك ميباشد. با توجه بـه علاقـه بـسياري از مـردم بـه نگهـداريپرندگان زينتي و توانايي بالقوه اين پرندگان در انتقال اشرشياكليO157:H7 به انسان، در ايـن مطالعـه بـه ارزيـابي آلـودگي پرنـدگانزينتي يزد به اشرشياكلي O157:H7 پرداخته شد.
مواد و روشها: تحقيق به روش توصيفي مقطعي انجام گرفت. تعداد 180 نمونه مدفوعي از پرندگان زينتي (تعداد 150 نمونه مـدفوعي از قناري (Serinus canari) و 30 نمونه مدفوعي از مرغ عشق (Agapornis personata)) از نقاط مختلـف يـزد جمـع آوري گرديـد و بـااستفاده از روشهاي باكتريشناسي و PCR به جست و جوي اشرشياكلي O157:H7 پرداخته شد.
يافته ها: ميزان آلودگي به اشرشياكلي در نمونه هاي مدفوعي قناري 7/72% (109 عدد از 150 نمونه) بود، اما در مرغ عشق اشرشياكلي يافت نشد. در هيچ كدام از نمونه ها اشرشياكلي O157:H7 يافت نگرديد.
نتيجه گيري: به نظر مي رسد كه مدفوع پرندگان زينتي يزد، منبع اشرشياكلي O157:H7 نمي باشد.
-19048237147

واژگان كليدي: اشرشيا كليO157:H7 ، پرندگان زينتي، PCR لطفاً به اين مقاله به صورت زير استناد نماييد:
[email protected]
Tahmasby H, Momtaz H, Salehi N, Rafiee Dolatabadi M, Yektaneh F. Prevalence of Escherichia Coli O157:H7 in pet
birds in Yazd, Iran. Pejouhandeh .5-252:)5(61;1102

مقدمه1
پرندگان زينتي مي توانند بعضي از بيماريها را در خود جاي دهند و به صاحبان خود منتقل گردانند. اگرچه مالكيت اين پرندگان بدون خطر نيست، اما بسياري از مردم در منزل خود از پرندگان زينتي مراقبت كرده و به اين ترتيب خود را در معرض بسياري از بيماريهاي مشترك باكتريايي، پروتوزوايي، قارچي، ويروسي يا انگلي قرار مي دهند (1).
سويههايي از اشرشياكليO157:H7 كه شيگاتوكـسين توليـدميكنند به عنـوان فلـور مـدفوعي در حيوانـات اهلـي سـالم و

*نويسنده مسؤول مكاتبات: حـسين طهماسـبي؛ شـهركرد، دانـشگاه شـهركرد،دانــشكده دامپزشــكي؛ تلفــن: 7325071-913-98 ؛+ پــست الكترونيــك:

عمــدتاً در نــشخواركنندگان مــي تواننــد حــضور يابنــد 2(). اشرشياكليO157 وروتوكسين زا در جوجههـاي گوشـتي ،(3) بوقلم ون ،(4) كب وتر 5() و پرنـدگان وح شي از قبي ل م رغنوروزي دريايي 6() و غاز 7() گزارش شده است.
اشرشياكلي، شـايعترين ميكروارگانيـسم فلـور لولـه گـوارشانسان و ساير حيوانات است، ولـي چنـدين نـوع پاتوژنيـك آنبيماريهاي مختلفي را در انسان ايجاد مي نمايد. در دهه گذشتهعفونت ناشـي از اشرشـياكلي O157 بـه عنـوان يـك بيمـارينوپديد مشترك بين انسان و حيوان در آمريكاي شمالي، اروپـاو ساير نقاط دنيا معضلات بهداشتي زيادي به بار آورده است وهرچند تعداد مبتلايان نسبت به پات وژنهاي روده اي ديگر نظيرسالمونلا يا كمپيلوباكتر خيلي كمتر است ولي مشخص گرديدهكه E. Coli مي تواند بيماري شديد و مـرگ آور ايجـاد نمايـد .
اين ارگانيسم براي اولين بار در سال 1982 يعنـي زمـاني كـهباعث بروز دو اپيدمي كوليت هموراژيك با علائـم كرامـپ هـايشكمي، اسها ل آبكي بدون تب يـا بـا تـب خفيـف گرديـد، بـه عنوان پاتوژن انساني شناخته شد. در سـال 1983، Karmali و همكاران (8) ارتباط بين عفونت با نوعي E. Coli كه توكسين شيگا توليد ميكند (ازجمله اشرشياكليO157:H7 ) و سـندرماورمي هموليتيك بعد از اسهال را كه بـا آسـيب حـاد كليـوي،ترومبوستيوپني و آنمـي هموليتيـك ميكروآنژيوپاتيـك همـراهاست نشان دادند (9).
به علت داشتن خصوصيات آنتيژن سوماتيكO شماره 157 و آنتيژن فلاژلرH شماره هفت به نام اشرشـياكليO157:H7 ناميده شده است. اشرشياكليO157 از نظر ژنتيكي شـبيه بـهاشرشــياكلي O157:H7 انتروپــاتوژنِ عامــل بــروز اســهال درشيرخواران سرتاسر دنيا مي باشد (10).
با توجه به علاقه بـسياري از مـردم در نگهـداري از پرنـدگانزينتــي و همچنــين اهميــت بــالاي بــاكتري اشرشــياكليO157:H7، در اين مطالعه به ارزيابي نقش پرندگان زينتـي درآلودگي به اين بـاكتري در منطقـه يـزد و در محـدوده زمـاني مربوط به سال 1389 پرداخته شد.

مواد و روشها
تحقيق به روش cross sectional انجـام گرفـت. تعـداد 180 نمونه مدفوعي از پرندگان زينتي (تعداد 150 نمونه مدفوعي از قناري (Serinus canari) و 30 نمونه مـدفوعي از مـرغ عـشق(Agapornis personata)) از نقاط مختلف يزد به وسيله سواب استريل جمعآوري گرديد.
جداسازي اشرشياكلي
سواب هـا مـستقيماً در محـيطTSB) Trypton Soy Broth )
(Merck, Germany) قرار داده شدند و در آزمايـشگاه بـر رويمحيط Merck, Germany) MacConkey) كشت داده شـده وسپس به مـدت 24 سـاعت در دمـاي 37 درجـه سـانتيگـ راد انكوبه گرد يدند. پرگنههاي صورتي رنگ جدا شده روي محـيطTSB كــشت داده شــدند و بــراي تــشخيص E. Coli در محيطهاي IMVIC تست گرديدند.
جست و جوي اشرشياكلي O157:H7
شماره 5، پي در پي 83، آذر و دي 1390 دكتر حسين طهماسبي و همكاران/ 253
جهت جست و جوي اشرشياكليO157:H7 به وسـيلهPCR از پرايمرهاي درج شده در جدول 1 كه قـبلاً توسـطGanon و همكاران (1997) و Paton (1998) به ثبت رسيدهاند استفاده شد (11 و 12). PCR در حجم 25 ميكروليتر 5(/2 ميكروليتربافر10X PCR ، 75/0 ميلي مول 2MgCl، 02/0 ميلـي مـولdNTP ، 5/1 واحد آنـزيمTaq پلـي مـراز، يـك ميكروليتـر بـاغلظت 10 ميكرومولار از هر پرايمر، 1 ميكروگرمDNA الگـو) انجام شد . دماهاي مورد استفاده از اين قـرار بودنـد: واسرشـتابتدايي در 94 درجه سانتيگراد به مدت 7 دقيقه و 35 سيكلاز قرار 94 درجه به مـدت 60 ثانيـه، 55 درجـه بـه مـدت 60 ثانيه، 72 درجه به مـدت 60 ثانيـه و گـسترش نهـايي در 72 درجه سانتيگراد به مدت 7 دقيقه . در پايان محـصولاتPCR روي ژل آگارز 1 درصد الكتروفورز گرديد.

جدول 1- مشخصات پرايمرها

اندازه
محصول توالي پرايمرها

F: 5´ CGGACATCCATGTGATATGG 3´ O 157 R: 5´ TTGCCTATGTACAGCTAATCC 3´ 259 bp
flic H7R:F: 5´ CAACGGTGACTTTATCGCCATTCC 3´ 5´ GCGCTGTCGAGTTCTATCGAGC 3´ 625 bp

يافته ها
در ايـن مطالع ه مجموعـاً 180 نمونـه مـدفوعي از پرنـدگان زينتي (تعداد 150 نمونه مدفوعي از قنـاري (Serinus canari) و 30 نمونه مدفوعي از مرغ عشق (Agapornis personata)) از نقاط مختلف يزد جمع آوري گرديد و بـا اسـتفاده از روشـهايباكتري شناسي وPCR به جست و جوي اين باكتري پرداختهشد. آلودگي به اشرشياكلي در نمونههاي مدفوعي مـرغ عـشقيافت نشد ، اما ميزان شيوع آن در قنـاري 66/72% (109 تـا از150 نمونــه) بــود. در هــيچ كــدام از نمونــه هــا اشرشــياكلي
.يافت نشد O157:H7

بحث
شش سوش بزرگ اشرشياكلي اسهال زا مي باشند:
(4 ،Enterinvasive (3 ،Enterotoxigenic (2 ،Enterhemorrhagic (1
Entroaggregative (5 ، Enteropathogenic و 6) Diffuse-adherent. قدرت بيماريزايي سوش هاي اين گروهها متفـاوت اسـت و هـر كدام داراي حـدت بيمـاريزايي و تركيـب خـاص پـادگن هـاي محيطي و سلولي هستند. در اين مطالعه به ارزيابي آلودگي بـه
مهمترين سروتيپ Enterhemorrhagic، اشرشياكليO157:H7 پرداخته شد.
باكتري اشرشياكليO157:H7 از جمله باكتري هايي است كه توجه محققان و دستاندركاران بهداشتي را بـه خـود معطـوفكرده است . با توجه به اينكه عامل اصلي انتشار، مخـزن اصـلياشرشياكليO157:H7 (گاو و محصولات غذايي بـا ايـن منـشأ) است بيشتر مطالعات و گزارشهاي موجود مربـوط بـه آلـودگياين محصولات بوده است (16-13) ، به طوري كه شـيوع ايـنپاتوژن در گوشت و محصولات حاصل از گوشت گاو بـين 1 تـا
8/27 درصد گزارش شده است (15).
مطالعات مختلف ، نتايج متفاوتي را از ميزان شـيوع سـروتيپ اشرشياكليO157:H7 در پرنـدگان زينتـي نـشان مـيدهنـد .
چنانچه در مطالعهSantaniello و همكاران 504 نمونه سـوابكلواك كبوتر از شهرNapoli واقع در ايتاليا جمعآوري گرديـدكه در اين بين 4 نمونـه آلـوده بـهO157:H7 يافـت شـد (5). همچنـين Shere و همكـاران از 99 پرنـده م ورد بررس ـي در حــوالي كارخانــه هــاي توليــد كننــده مــواد لبنــي در ايالــتWisconsin آمريكا در يك كبوتر آلودگي بهO157:H7 يافتند
(17). در مطالعه ديگر در استانFujian چين شيوعO157 درحيوانات مختلف مورد بررسي قرار گرفت، طي اين تحقيق ايـنپــاتوژن از كبــوتر نيــز جداســازي گرديــد (18). در مطالعــه LeJeune و همكاران بر روي پرستوهاي اروپايي، 3% از نمونهها به O157:H7 آلوده بودند (19).
254/ دوماهنامه پژوهنده شيوع آلودگي پرندگان زينتي به اشرشياكلي …
اما مشابه با بعضي از مطالعات پيشين در ساير كشورها، نتايجايـن مطالعـه نيـز عـدم وجـود اشرش ياكلي O157:H7 را در پرندگان زينتي منطق ه مورد بررسي نشان ميدهـد . بـه عنـوانمثال طي مطالعه اي كه توسطMorabito و همكاران در ايتاليا بر روي نمونههاي مدفوعي كبوتر صـورت گرفـت اشرشـياكليشيگاتوكسين زا در 70 نمونه از 649 نمونه اي كه مورد بررسـيقرار گرفته شده بود يافت شد، اما سروتيپ اشرشـياكليO157 در هيچ كدام يك از نمونـههـاي مـورد بررسـي يافـت نگرديـد (20). در مطالعهاي نيز كه در ژاپن صورت گرفت، 108 نمونـهمورد بررسي قرار گرفت، اما همه نمونههـا از نظـر اشرشـياكليO157 منفي بودند (21). طي تحقيقي كه در سال 2009 روي پرســتوهاي وحــشي اروپــايي صــورت گرفــت نيــز ســروتيپ اشرشياكليO157 در هيچ كدام يك از نمونههاي مورد بررسي يافت نگرديد (22).
از آنجايي كه در نمونههاي مدفوعي مرغ عـشق، آلـودگي بـهاشرشياكلي يافت نشد، ميتوان چنين برداشت كـرد كـه مـرغعشقهاي اين منطقه منبع يا ناقل سـاير سوشـهاي بيمـاريزاياشرشياكلي نيز نيـستند. اگرچـه در نمونـههـاي اخـذ شـده ازقناري، اشرشياكليO157:H7 يافت نشد، اما به دليل ايـن كـهشيوع اشرشياكلي بـالا بـود، احتمـال حـضور سـاير سوشـهايبيماريزاي اشرشياكلي در نمونههاي مدفوعي قناري وجود داردكه در اين زمينه انجام تحقيقات بيشتر توصيه مي گردد.

نتيجه گيري
مشابه بـا بعـضي از مطالعـات صـورت گرفتـه در كـشورهاي ديگ ر(20 و 21)، ايـن مطالع ه نيـز عـدم وجـود اشرشـياكلي O157:H7 را در مـدفوع پرنـدگان زينتـي منطقـه يـزد نـشان مي دهد. اگرچه نميتـوان پرنـدگان زينتـي ايـن منطقـه را بـه عنوان منبع يا ناقـل اشرشـياكليO157:H7 تلقـي نمـود ، امـاممكن است كه پرنـدگان زينتـي خـصوصاً قنـاري ناقـل سـايرسوشهاي بيماريزاي اشرشياكلي باشـند كـه بـا توجـه بـه ايـنمسأله تحقيقات بيشتر در اين زمينه توصيه مي گردد.

تشكر و قدرداني
نويسندگان مراتب تشكر خود را از كليه عزيزاني كه مـا را در انجام اين مطالعه ياري نمودند اعلام مي دارند.

REFERENCES
120812967667

Krauss H. Zoonoses: Infectious Diseases Transmissible From Animals to Humans. 3rd ed. Washington DC: American Society for Microbiology Press; 2003.
Cízek A, Alexa P, Literák I, Hamrík J, Novák P, Smola J. Shiga toxin-producing Escherichia Coli O157 in feedlot cattle and Norwegian rats from a large-scale farm. Lett Appl Microbiol 1999;28(6):435-9.
Hafez HM, Schulze D, Kosters J. Surveillance on verotoxin producing E. Coli in broiler flocks and processing plants, p. 101. Proceedings of Xth International Congress of the World Veterinary Poultry Association; 1997; Budapest, Hungary.
Heuvelink AE, Zwartkruis-Nahuis JT, van den Biggelaar FL, van Leeuwen WJ, de Boer E. Isolation and characterization of verocytotoxin-producing Escherichia Coli O157 from slaughter pigs and poultry. Int J Food Microbiol 1999; 52(1-2): 6775.
Santaniello A, Gargiulo A, Borrelli L, Dipineto L, Cuomo A, Sensale M, et al. Survey of Shiga toxin-producing Escherichia Coli O157:H7 in urban pigeons (Columba livia) in the city of Napoli, Italy. Italian Journal of Animal Science 2007;6(3):313-6.
Wallace JS, Cheasty T, Jones K. Isolation of verocytotoxin-producing Escherichia Coli O157 from wild birds. J Appl Microbiol 1997;82(3):399-404.
Smith HR, Rowe B, Adak GK, Reilly WJ. Shiga toxin (verocytotoxin)-producing Escherichia Coli in the United Kingdom. Washington DC: ASM Press; 1998. p.49-58.
شماره 5، پي در پي 83، آذر و دي 1390 دكتر حسين طهماسبي و همكاران/ 255
Karmali MA, Steele BT, Petric M, Lim C. Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia Coli in stools. Lancet 1983;1(8325):619-20.
Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, et al. Hemorrhagic Colitis associated with a rare Escherichia Coli serotype. N Engl J Med 1983;308(12):681-5.
Whittam TS, Wolfe ML, Wachsmuth IK, Orskov F, Orskov I, Wilson RA. Clonal relationships among Escherichia Coli strains that cause hemorrhagic Colitis and infantile diarrhea. Infect Immun 1993;61(5):1619- 29.
Gannon VP, D’Souza S, Graham T, King RK, Rahn K, Read S. Use of the flagellar H7 gene as a target in multiplex PCR assays and improved specificity in identification of enterohemorrhagic Escherichia Coli strains. J Clin Microbiol 1997;35(3):656-62. 12. Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia Coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. Coli hlyA, rfbO111, and rfbO157. J Clin Microbiol 1998;36(2):598-602.
Baek SY, Lim SY, Lee DH, Min KH, Kim CM. Incidence and characterization of Listeria monocytogenes from domestic and imported foods in Korea. J Food Prot 2000;63(2):186-9.
Elder RO, Keen JE, Siragusa GR, Barkocy-Gallagher GA, Koohmaraie M, Laegreid WW. Correlation of enterohemorrhagic Escherichia Coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proc Natl Acad Sci U S A 2000;97(7):2999-3003.
Reid CA, Small A, Avery SM, Buncic S. Presence of food-borne pathogens on cattle hides. Food Control 2002;13(67):411-5.
Stampi S, Caprioli A, De Luca G, Quaglio P, Sacchetti R, Zanetti F. Detection of Escherichia Coli O157 in bovine meat products in northern Italy. Int J Food Microbiol 2004;90(3):241-5.
Shere JA, Bartlett KJ, Kaspar CW. Longitudinal study of Escherichia Coli O157:H7 dissemination on four dairy farms in Wisconsin. Appl Environ Microbiol 1998;64(4):1390-9.
Chen K, Guo W, Cheng F, Lin C, Lin J, Dong X. Investigation on E. Coli O157 in Fujian, China. Zhonghua Yu Fang Yi Xue Za Zhi 2000;34(3):156-8. (Full text in Chinese)
LeJeune J, Homan J, Linz G, L. Pearl DL. Role of the European Starling in the Transmission of E. Coli O157 on Dairy Farms. Proceedings of the 23th Vertebrate Pest Conference; 2008; Davis, USA.
Morabito S, Dell’Omo G, Agrimi U, Schmidt H, Karch H, Cheasty T, et al. Detection and characterization of Shiga toxinproducing Escherichia Coli in feral pigeons. Vet Microbiol 2001;82(3):275-83.
Tanaka C, Miyazawa T, Watarai M, Ishiguro N. Bacteriological survey of feces from feral pigeons in Japan. J Vet Med Sci 2005;67(9):951-3.
Gaukler SM, Linz GM, Sherwood JS, Dyer NW, Bleier WJ, Wannemuehler YM, et al. Escherichia Coli , Salmonella, and Mycobacterium avium subsp. paratuberculosis in wild European starlings at a Kansas cattle. Avian Dis 2009;53(4):54451.



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید