پژوهن ده (سال شانزدهممجله ، شماره پژوهشي5آذر ، و پي دي در دانشگاه پي 1390 علوم 83، پزشكي صفحات شهيد234 تا 240بهشتي) تاريختاريخ پذيرشدريافت مقالهمقاله:: 1/1115//4/13901390

بررسي مهار بيان ژن رپرسور گاماگلوبين با روش RNAi در رده سلولي
اريتروئيدي 562 K با هدف ژن درماني بتاتالاسمي
دكتر علي محمد اصغريان1*، دكتر مهدي بنان2، دكتر حسين نجم آبادي3

مربي، گروه زيست شناسي سلولي مولكولي، دانشگاه آزاد اسلامي واحد تنكابن
استاديار، مركز تحقيقات ژنتيك، دانشگاه علوم بهزيستي و توانبخشي
استاد، مركز تحقيقات ژنتيك، دانشگاه علوم بهزيستي و توانبخشي

چكيده
سابقه و هدف: بتاتالاسمي از بيماريهاي ژنتيكي است كه سبب كـم خـوني حـاد در افـراد مبـتلا مـي شـود . يكـي از روشـهاي درمـانبتاتالاسمي، القاي ژن گاماگلوبين جنيني است. كمپلكس پروتئينيDRED از رپرسورهاي گاماگلوبين است كه از دو زير واحـد متـصلشونده به DNA، به نام 2 TRو 4TR تشكيل شده است. يك روش جالب جهـت افـزايش بيـان گامـاگلوبين، مهـار بيـان 4TR توسـطمولكول هايsiRNA ميباشد. هدف از اين تحقيق ،راه اندازي سيستمRNAi به منظـور مهـار بيـان ژن 4TR سـلولهـاي اريتروئيـدي562K و بررسي ميزان بيان گا ماگلوبين مي باشد.
مواد و روشها: از ليپيد2000 lipofectamineTM جهـت ترانسفكـشن و از پلاسـميد گزارشـگرpSV-β-Galactosidase جهـت بررسـيراندمان استفاده شد. بعد از ترانسفكشن TR4 siRNA، ميزان بيـان ژن 4TR و گامـاگلوبين بـا روشReal-time PCR در سـلولهـاي562K تعيين شد.
يافته ها: نتايج نشان داد با تركيب 2000 LipofectamineTM،40% از سلول هاي 562K ترانسفكت شـدند. بيـان 4TR توسـطsiRNA 4TR حدود 44% كاهش داشت اگرچه القاي ژن گاماگلوبين 18/1 برابر بود.
نتيجهگيري: گرچه بيان 4TR تا 44% مهار شد ولي القاي قابل ملاحظه ژن گاماگلوبين مشاهده نشد . براي عدم القـاي گامـاگلوبين دومورد قابل بحث است. اول اينكه ميزان ترانسفكشن در سلولهاي 562K ، مهار بيان ژن 4TR را محدود مي سازد. دوم اينكه شايد مهـار4TR و 2TR بطور همزمان در سلول 562K سبب القاي گاماگلوبين شود. در مجموع با سيستم RNAi در سلول 562K، مهار ژن 4TR رخ داد ولي مهار بيان اين ژن با روش RNAi به تنهايي نمي تواند سبب القاي ژن گاماگلوبين شده و در ژن درماني استفاده شود.
واژگان كليدي: بتاتالاسمي، TR4 siRNA، مهار 4TR، گاماگلوبين، سلول هاي 562 K

لطفاً به اين مقاله به صورت زير استناد نماييد:
Asgharian AM, Banan M, Najmabadi H. Evaluation of knocking down of the RNAi mediated gamma globin repressor into K562 cells, for gene therapy of beta-thalassemia. Pejouhandeh .04-432:)5(61;1102

مقدمه1
هموگلوبين مولكـولي اسـت كـه از دو زنجيـره شـبهα و دوزنجيره شبهβ گلوبين همراه بـا چهـار مولكـول هـم (Heme) متصل به آهن تشكيل شده اسـت و در انتقـال اكـسيژن و دي اكسيد كربن نقش مهمي را ايفـا مـي كنـد . در دوران جنينـي، هموگلـوبين از نـوع جنينـي يـا 2α2γ مـي باشـد در حـالي كـه

* نويسنده مسؤول مكاتبات : دكتر علي محمد اصغريان؛ مازنـدران ، تنكـابن ، ولـيآباد، دانـشگاه آزاد اسـلامي واحـد تنكـابن؛ تلفـن: 2958644-912-98+؛ پـستالكترونيك: [email protected]

هموگلوبين اصلي در دوران بلوغ هموگلـوبين نـوع 2α2β اسـت 1-4(). در فرآيند تمايز سلولهاي گلبول قرمز، غير فعال شدن ژن گامـاگلوبين و فعـال شـدن ابتـ گلوبين يـك رخـداد مهـم محسوب مي گردد و اگر در اين فرآيند تغيير بيان ژن، اختلاليايجـاد شـود مـي توانـد منجـر بـه ايجـاد بيماريهـايي از قبيـل كم خوني ناشي از سلولهاي داسي شـكل و بتاتالاسـمي شـود 5(). شايان ذكر است كه شمار مبتلايان به بتاتلاسمي در آسياو خصوصاً در ايران قابل توجه است. بيمـاران مبـتلا بـه آنمـيداسي شكل دچار انسداد عروقي بوده و به مراقبتهـاي طـولانيمدت نياز داشته و طول عمر آنها نيـز كوتـاه مـي باشـد 3(). از اينرو درمان بينظمـي هـاي هموگلـوبين همـواره مـورد توجـهمي باشد.
از روشهاي جديد مورد توجه براي درمان بي نظمي هاي ناشـياز هموگلوبين، ژن درماني و تغيير الگوي بيان ژن گامـاگلوبين ودوباره فعال سازي اين ژن در سلولهاي اريتروئيدي بالغ ميباشد 2(). اين تئوري از شواهد طبيعي، كه به عنـوان فنوتيـپ HPFH
(Hereditary Persistence of Fetal Hemoglobin) ناميــده مي شود، نـشأت گرفتـه اسـت. در بيمـاران مبـتلا بـهHPFH ، گاماگلوبين برخلاف انتظار در سلولهاي اريتروئيدي بالغ بيـانمي شود و علائم بيماري نيز در آنها تا حد زيادي كاهش داشتهو بيمـاران ط ول عمـر بيـشتري دارن د. دوب اره فع ال سـازي گاماگلوبين كمبود بتاگلوبين را در سلولهاي اريتروئيدي بـالغجبران مينمايد. در نتيجـه بيـان گامـاگلوبين در سـلول هـاياريتروئيدي بالغ ميتواند در تخفيف حدت كمخوني در بيمارانبتاتالاسمي و بيماران كمخوني داسي شكل مفيد باشد 6-8().
در اين زمينه مشخص شده كـه م جموعـه پروتئينـيDRED (Direct repeat erythroid-definitive) بــه عنــوان فــاكتور ترانس اكتينگ مهاركننده در تنظيم رونويسي بيان گاماگلوبين دخالت دارد . اين مجموعه حاوي دو زيرواحد متصل شونده بـه
DNA ب ه نام 2Testicular Receptor) TR) و 4TR است كه با ميل اتصالي زياد به توالي Direct Repeat) DR)كه در پروموتر گاما و اپسيلون گلوبين قرار دارد وصـل مـي شـوند، در حاليكـه ژنهاي بتاگلوبين انساني مكانهـايDR نداشـته و بـهDRED پاسخ نمي دهند 9().
مهـار بيـان ژن گامـاگلوبين بـه واسـطه مجموعـه پروتئينـي DRED و توسط آزمايشاتOmeri و همكارانش بـا آزمايـشاتموتاسيون زايي تأييد شده است . آنها نشان دادنـد كـه بـا مهـارات صال DRED در ت والي DR پروم وتري، بي ان هموگل وبين جنيني افزايش مييابد (9 و 10). در نتيجه اين تئوري مطـرحشد كه در سلول هاي بالغ اريتروئيدي مهار گاماگلوبين ممكـناست به دليل عملكردDRED باشد. از طرف ي نتـايج موشـهايتراريخت نشان داده كه ميزان افزايش بيان ژن گامـاگلوبين درجنينهاي موتانت با فنوتيپ -/-TR2-/+TR4 نسبت به موتانت بـافنوتيپ +/-TR2-/- TR4 بيشتر است . بنابراين نقش 4TR نسبتبه 2TRدر القاي گاماگلوبين بيشتر است (11).
شايان ذكر است كه در سلولهاي ان ساني و سلول هـاي مغـز
استخوان، +34CD و -34CD بالغ ، بيان و تجمعTR2 mRNA وTR4 mRNA وجود دارد . بنابراين ميتوان از نتايج سيـستممهار ژني RNAi در سلولهاي 562K در سـلولهـاي بنيـاديخـوني نيـز اسـتفاده نمـود ( و9 11). در سـالهاي اخيـر روش جديدي در ژن درماني بيماريهاي ژنتيكي (از قبيل بينظمي هاي هموگلــوبين) مطــرح شــده اســت كــه در آن بــا اســتفاده ازمولكول هايsiRNA ميتوان در مرحلـه بعـد از رونويـسي بيـانژن ها را كنترل نمود. هدف اصـلي ايـن مطالعـه نيـز اسـتفاده ازسيستمRNAi به منظور ژن درماني بي نظمي هموگلوبين بـود (12). در اين تحقيق اثرات مهار بيان ژن 4TR توسطsiRNA
4TR بررســي و اثــرات آن در افــزايش بيــان گامــاگلوبين درسلول هاي مدل اريتروئيـدي 562K بررسـي شـده اسـت. ايـنمطالعه مشخص ميكند كه آيا با مهار بيـان 4TR (كـه ناحيـهمتصل شونده اصـلي رپرسـورDRED اسـت) توسـط سيـستمRNAi، مي توان القاي گاماگلوبين را در سلولهاي اريتروئيـديبالغ K652 دوباره فعال نمود يا خير.

مواد و روشها
كشت سلول هاي562K: استفاده از سلولهاي 562K كه ازرده سلول هـاي مـدل اريتروئيـدي بـا منـشأ انـساني اسـت درمطالعات تنظيم بيان ژن هموگلوبين رايـج مـي باشـد. محـيطك شت مناس ب ب راي اي ن رده س لولي مح يط 1640RPMI (شركت Biosera) همراه با 10% سرم جنـين گـاوي (شـركت Biosera) و 1% آنت ي بيوتي ك پنـي س يلين-استرپتوماي سين
(شركت Biosera) بود. اين سلولها در ظروف كشت 6 چاهكيو انكوباتور با 2CO 5% و 95% رطوبت كشت داده شدند.
ترانسفكشن پلاسميدpSV-β-Galactosidase در سلول هاي
562K با اسـتفاده از تركيـب 2000Lipofectamine TM: ايـنآزمـايش بـه ايـن منظـور انجـام شـد تـا قبـل از ترانسفكـشنمولكــول هــاي siRNA ميــزان مناســب از تركيــب ليپيــدي2000Lipofectamine TM (از شــركت Invitrogene) تعيــين شود. جهت بررسي راندمان ترانسفكشن (انتقـال ژن) نيـاز بـه وكتورpSV-β-Galactosidase ميباشد. اين وكتور، از شـركتPromega تهيه شد كـه داراي ژن گزارشـگر بتـا گالاكتوزيـدارتحت كنترل پرومـوتر سـايتومگالوويروس اسـت و براحتـي دررده هاي سلولي پستانداران قابل بررسي و بيان است. سلول هاي پستانداران كه ايـن پلاسـميد را دريافـت كننـد در مـشاهداتميكروسكوپي آبي رنگ مي شوند.
سلول هاي 562K در محيط 1640RPMI و در شرايط ذكر شده گرما دهي شدند تا تعداد سلول هـا بعـد از يـك شـبانه روز بـه 105 سلول در هر ميليليتر برسد . سپس براي هر چاهك كشت مقدار1 ميكروگرم ازDNA پلاسميدpSV-β-Galactosidase انتخـاب و بـا200 ميكروليتر محيط 1640RPMI بدون سرم مخلوط شـد و20 دقيقـه در دمـاي آزمايـشگاه قـرار داده شـد تـا كمـپلكس Lipofectamine TM2000 -DNA ايجاد شـود . سـپس مقـدار 600 ميكروليتر محيط بدون سرم 1640RPMI به سلولهـايهـ ر چاهـ ك اضـ افه شــد و در ادامــه كمـ پلكس-DNA 2000Lipofectamine TM به آرامـي روي سـلولهـا ريختـه وپليت چند بار بـه عقـب و جلـو تكـان داده شـد تـا كمـپلكس Lipofectamine TM2000 -DNA در سطح پليت كاملا پخش گردد. پليت به مدت 4 ساعت در انكوباتورC o37 گرمادهي شدو بعد از 4 سـاعت، 2 ميلـي ليتـر محـيط 1640RPMI كامـلهمراه با سرم جنيني گاوي به سلول ها اضـافه گرديـد. سـپسسـلول هـا 48 سـاعت در انكوبـاتور Co37 بـا 2CO و 5% 95% رطوبــت قــرار داده شــدند . جهــت بررســي حــضور فعاليــتبتاگالاكتوزيداز از كيت رنگآميزي بتاگالاكتوزيـداز (از شـركت Roche) استفاده شد. براي اين منظور ابتدا سلولهـاي 562K ترانسفكت شده در دورg 1000 سانتريوفوژ و سپس با محلولتثبيت كننده و رنگآميزي مطـابق بـا روش منـدرج در كيـترنگ آميزي شدند.
طراحي و سنتز مولكول هـاي TR4 siRNA وNegative siRNA: مولكول هايsiRNA مـورد آزمـايش شـامل siRNA 4TR (بـــــصورت Validated TR4 siRNA) و Negative siRNA (ساخت شركتMWG ) بود. تـواليTR4 siRNA در سايتAmbion و مطابق با معيارهايReynold طراحي شـدهبود. توالي Negative siRNA نيز توسط شركت MWG سـنتزشده بود و شامل توالي بود كه با هيچ كـدام ازmRNA سـلولدر موش انـسان و رت مكمـل نبـوده و بعنـوان كنتـرل منفـيآزمايشات در نظرگرفته ميشد. سپس با حل كردن نمونههـايTR4 siRNA و siRNA Negative در آب اســـتريل بـــدونRNase، محلولهاي با غلظت 20 نانومول از آنها تهيه شد. توالي TR4 siRNA و Negative siRNA در جـدول 1 آورده ش ده است.

Negative siRNA وTR4 siRNA جدول 1- توالي
288036-39278

GGAGGAAGTGATCCGAAAA TR4 siRNA
AGGUAGUGUAAUCGCCUUG Negative siRNA
ترانسفكـــشن TR4 siRNA و Negative siRNA در سلول هاي 562K توسط 2000Lipofectamine TM: پـس ازتعيين بهترين مقـدار تركيـب 2000Lipofectamine TM (كـهمراحــل آن در بــالا ذكــر شــد ،) 2 ميكروليتــر از تركيــب 2000Lipofectamine TM بـــه 100 ميكروليتـــر محـــيط
1640RPMI بدون سرم اضافه و پيپت گرديد . اين مخلـوط5 دقيقه در دماي اتاق قرار داده شـد. سـپس 100 ميكروليتـر ازمحيط 1640RPMI بدون سرم در لوله 5/1 ميلي ليتر اضـافه وپي پت گرديد. نمونـه هـايTR4 siRNA و Negative siRNA به اندازهاي برداشته شد 4( ميكروليتر ) كـه در نهايـت غلظـ ت آنها در هر چاهك آزمايش بـه 100 نـانومول برسـد. بعـد از5
دقيقه، نمونه هـاي 2000Lipofectamine TM و siRNA رقيـقشده در 1640RPMI با يكديگر مخلوط و به مدت 20 دقيقـهدر دمــاي اتـ اق قــرار داده شـ د تـ ا كمـ پلكس siRNA- 2000Lipofectamine TM ايج اد گـردد. بع د از 20 دقيقـه،
كمپلكس هـاي Lipofectamine TM2000 -siRNA بـه ميـزان400 ميكروليتر به سـلولهـاي 562K اضـافه گرديـد. سـپسپليت چند بار به عقب و جلـو حركـت داده شـد تـا كمـپلكس Lipofectamine TM2000 -siRNA در تم ام سـطح محـيط پخش شود . پليت به انكوبـاتورC o37 بـا رطوبـت 90% و 2CO 5% انتقـال داده شـد. بعـد از 4 سـاعت 2 ميلـي ليتـر محـيط
1640RPMI كامل به سلول ها اضافه گرديد. مجدداً پليـت بـهمدت 72 ساعت در انكوباتور قرار داده شـد تـا ميـزان كـاهشبيان ژن بعد از اين مدت بررسي گردد.
لازم به توضيح است كه در كليـه آزمايـشات ترانسفكـشن از كنتـــرل مثبـــت اســـتفاده شـــد كـــه در آن پلاســـميد pSV-β-Galactosidase، در همـــان شـــرايطي كـــه بـــراي مولكــول هــاي siRNA اعمــال شــد، در ســلول هــاي K562 ترانسفكت گرديد.
مرحله استخراجRNA و سنتزcDNA : بعد از 72 سـاعتRNA سلول هاي 562K كه بـا مولكـولهـايTR4 siRNA و
Negative siRNA ترانـسفكت شـده بودنـد اسـتخراج گرديـد
(مطابق با روش كيـتRNX-PLUS سـيناژن). بـا اسـتفاده از پيپت، سـلول از چاهكهـاي كـشت برداشـته و سـپس در دور 1000 دور در دقيقه به مدت 5 دقيقه سانتريوفوژ شدند. پـساز آن، مايع رويي برداشته و رسـوب سـلولي انتخـاب گـشت ومراحل تخليصRNA بصو رت زير انجام گرديد: به هر كـدام ازرسوبهاي حاصـل، يـك ميلـيليتـر از محلـولRNX-Plus (از شركت سيناژن) اضافه و به مدت 5-10 دقيقه در دمـاي اتـاققرار داده شد. سپس بـه هـر نمونـه 200 ميكروليتـر كلروفـرم (Merck) افزوده شـده و بعـد از 5 دقيقـه در دورrpm 13000 بمدت 15 دقيقـه سـانتريوفوژ گرد يـد. پـس از آن، فـاز رويـيانتخاب و هم حجـم آن ايزوپروپانـل (Merck) اضـافه و كـاملاً مخلوط گرديد و سپس در دورrpm 13000 سانتريوفوژ شد. به رسوبهاي حاصل، 1 سـيسـي اتانـل (Merck) سـرد اضـافه و س پس در rpm7000 ســانتريوفوژ گردي ـد. در انتهــا، رســوب حاصل در 50 ميكروليتر آب مقطر ديونيزه اتـوكلاو شـده حـلشد. كيفيتRNA استخراج شده با اندازهگيـري جـذب نـوري280/260 و بررســـي در ژل RNA داراي 1% آگـــاروز، بـــا شناسايي باندهايsRNA 18 وsRNA 28 ارزيابي شـد . سـپس ب ا نمون هه اي RNA اسـتخراج شـده، ب ا اسـتفاده از كي تOminiScript (از شركتQiagen ) و با روش مندرج در كيـتcDNA سنتز شد.
جدول2: توالي هاي پرايمري 4γ ، TR گلوبين و GAPDH براي واكنش Real time PCR
توالي پرايمر
5′ GGGAAGGCTCCTGGTTGTCTA 3′ γ-globin forward primer
5′ TCTTGCCATGTGCCTTGACTT 3′ γ-globin Reverse primer
5′ TCCCCACGCATCCAGATAATC 3′ TR4 Forward primer
5′ GATGTGAAAACACTCAATGGGC 3′ TR4Reverse primer
5′ GGTGGTCTCCTCTGACTTCAACA 3′ GAPDH forward primer
5′ GCTGCATTGGTCATGGTTAATGT 3 GAPDH reverse primer
جهت بررسي ميزان مهـار Real-time PCR آزمايشات و القاي ژن گاماگلوبين: بـراي ايـن TR4 بيان ژن رپرسور از شــركت) Quanifast SYBR GREEN منظــور از كيــت (ABI-7500مـــدل) Real-time PCR و دســـتگاه (Qiagen (Relative- استفاده شد. در اين مطالعه از روش كمي-نـسبياستفاده شد كـه در آن بيـان يـك ژن هـدف quantification) به نـام (Housekeeping gene) نسبت به بيان يك ژن خانه دار
Glyceraldehyde 3- phoshpodehydrogenase) GAPDH) انجام ميشود. مراحل واكنش مطابق با روشي كه در كيت قيدشده بود انجام گرفت. شرايط واكنشPCR بـصورت زيـر بـود :
دناتوراسيون اوليه 95 درجه سـانتيگـراد 5 دقيقـه، اتـصال دردماي 95 و 60 درجه سانتيگراد به ترتيب 10 و 30 ثانيـه بـاتعداد چرخه هاي 40 بـار. در ايـن روش رنـگ سـايبرگرين بـهمولكولDNA دو رشتهاي متصل و فلورسانس ساطع ميكنـد .
سپس با استفاده از معيار CT (يا سطح آستانه) و با فرمول زيرميزان بيان ژن 4TR نسبت به ژنGAPDH ارزيابي مـيشـود (13). تـوالي پرايمرهـاي مـورد نيـاز جهـتReal time PCR طراحي شده از سايت primer Bank در جدول 2 آمده است.
2ΔΔCT =2(ΔTR4- ΔGAPDH)

يافته ها
نتيجه ترانسفكشن پلاسميد pSV-β-Galactosidase در
سلول هـاي 562K بـا تركيـب 2000Lipofectamine TM: سلول هايي كه آبيرنگ شدهاند، ژن گزارشگر بتاگالاكتوزيداز رادريافت كردهاند كه بـا رنـگآميـزي بتاگالاكتوزيـداز مـشخصشده اند (شكل1). در اين آزمـايش 40% از سـلولهـا ي 562K پلاسميد گزارشـگر را دريافـت داشـتند. تعـدادي از سـلولهـا كمرنگ بودند كه به دليل بيان كـم ژن گزارشـگر در آنهاسـت. در مجموع راندمان ترانسفكشن با توجه بـه اينكـه سـلولهـا ي 562K از دسته سلول هاي معلق هستند قابل قبول بود. لازم به توضيح است كه در چاهكهاي ديگر مولكولهاي TR4 siRNA و Negative siRNA ترانسفكت شدند و مي توان انتظار داشـتكه حداقل 40 از% سلول هـاي 562 K مولكـول هـايsiRNA را دريافت داشتند.
نتيجه استخراجRNA از سلول هاي 562K ترانـسفكتشده با مولكولهـاي TR4 siRNA و Negative siRNA: در كليـه مراحـل تحقيـقRNA اي جهـت سـنتزcDNA اسـتفادهمي شد كه كيفيـت و كميـت آن بـالا بـود. بانـدهاي مربـوط بـهsRNA 18 وsRNA 28 كاملاً مشخص و متمايز اسـت (شـكل2). مقـدارRNA اسـتخراج شـده حاصـل از سـ لولهـاي K562 ترانس سفكت ش ده ب ـاsiRNA TR4 و siRNA Negative، ب ه ترتيـب 1211 و 1256 ميكروگـرم بـر ميلـ يليتـر بـوده اسـت.
همچنين در كليه موارد، جذب نـوريRNA اسـتخراج شـده درطول موج 280⁄260 بيشتر از 8/1 بود كـه نـشاندهنده كيفيـتبالاي RNA است.
تعيين ميـزان كـاهش ژن 4TR در سـلول هـاي 562K ترانسفكت شده با مولكولهـاي TR4siRNA وNegative siRNA: منحني هاي تكثير آزمايشات Real-time PCR مربـوطبه سلول هاي 562K ترانسفكت شـده بـا مولكـول هـايsiRNA 4TR در شكل 3 آمده اسـت. آزمايـشات تعيـين مهـار بيـان ژن
4TR توسطTR4 siRNA در سه آزمايش مستقل تكرار شد كهبطور متوسط به ميزان 44% كاهش داشت.
ميـزان القــاي ژن گامـاگلوبين در ســلول هــاي 562K
ترانسفكت شده باTR4 siRNA : شكل 4 منحني هـاي تكثيـرمربوط به ژن گاماگلوبين نسبت به ژنGAPDH را در سلولهاي K562 بعد از مهار بيان ژنTR4 نـشان مـيدهـد . البتـه لازم بـهتوضيح است كه اين آزمايش نيز سه بار به صورت مـستقل تكـرار شده است كه ميانگين القاي ژن گاماگلوبين 18/1 برابر بود.

شكل1: تصويري از سلول هاي 562K ترنسفكت شده بـا پلاسـميدpSV-β-Galactosidase. سلول هاي آبي رنگ، بـا شـدت رنگهـايمختلف بسته به ميزان بيان ژن، ترانسفكت شدهاند و سـلولهـايبي رنگ ترانسفكت نشدهاند.

866394-1575053

TR4 RNA Negative RNA

TR4 RNA Negative RNA

٢٨ SrRNA
١٨ SrRNA

شـكل 2: كيفيـت RNA اسـتخراج شـده از سـلول هـاي 562K ترانسفكت شده با مولكولهاي TR4 siRNA و Negative siRNA.

بحث
در سالهاي اخير شواهد جالبي از پتانسيل درمانيsiRNA بدستآمده است . مولكول هايsiRNA بيان ژن را از طريق فرآيند وابـستهبه آنزيم در مرحله بعد از رونويسي مهار ميكننـد . ايـن مولكـولهـا ميتوانند از آلودگي سلولهاي پستانداران به ويروس از قبيلHIV ، هپاتيت و آنفـولانزا جلـوگيري كننـد. در ايـن روش مولكـولهـايsiRNA باعث خاموش سازي بيان ژنهاي بيماريزا ميشـوند (12). پتانسيل بالاي سيستم RNAi باعث شده تا اين مولكول ها در ژن درماني بيماريهاي ناشي از بينظمي هـاي هموگلـوبين نيـز مـوردتوجه قرار گيرند. در اين تحقيق پتانسيل مهار كننـدگيsiRNA در سلول هاي 562K به منظور مهار ژن 4TR بررسي شده است و نتايج تحقيق در سلول هاي بنيادي خوني قابل اجرا است.
سلول هاي 562K از جمله سلولهايي هستند كه مشخصات يك
سـلول اريتروئيـدي را نـشان مـ يدهـد. آنهـا گليكوفـورين هـا و گليكوپروتئين هـاي سـطحي سـلولهـاي اريتروئيـدي را توليـدمي كنند. دو تركيب همـين (Hemin) و سـديم بـوتيرات سـببتجمـع هموگلـوبين جنـين و پيـشرفت رونـد تمـايزي در آنهـا مي گردد. 562K خصوصيات سلولهـاي پـيشسـاز اريتروئيـديجنيني را نشان ميدهد بطوري كه ژن اپسيلون و گاماگلوبين درآنها بيان مي گردد ولـي بتـاگلوبين بيـان نـدارد (14). از ايـن رو سلول هاي 562K در مطالعاتي كه با هدف بررسي تغيير بيان ژن گلـوبين، خـصوصاً بـا هـدف افـزايش بيـان ژنγ گلـوبين انجـام مي گيرد مدل سلولي مناسبي مـيباشـند (14). از طرفـي طبـقگزارشاتomeri ژن 4TR در سلولهاي 562K بيان بالايي دارد(10) و از اينــرو اثــرات مهــار ژن TR4 و افــزايش بيــان ژن گاماگلوبين در اين سلولها قابل بررسي است.
نتايج حاصل از آزمايشات Real-time PCR در تحقيـق حاضـرحاكي از آن است كه مولكولهاي TR4 siRNA توانستند بيـانژن 4TR را به ميزان 44% در سـلول هـاي مـدل 563K كـاهشدهند كه در آزمايشات بر پايه ترانسفكـشن مـوقتي قابـل توجـهبود. اين نتايج با مطالعات قرهسوران و همكاران نيز قابل مقايـسهاست كه توانستند توسـط MBD2 siRNA ميـزان بيـان ژن 2 MBD را در سلولهاي اريتروئيدي تا 35% كاهش دهند (15).
توجه بـه ايـن نكتـه ضـروري اسـت كـه از مهمتـرين مراحـلمطالعات تنظيم بيـان ژن توسـطRNAi ، انتقـال مولكـولهـايsiRNA به داخل سلولها مي باشـد. مطالعـات مختلفـي نـشانداده كه ترانسفكشن سلولهاي سوسپانـسيون از قبيـل 562K و سلولهاي با منشأ خوني به سادگي سلولهاي چسبنده نيست وبا روشهاي انتقال ژن چون الكتروپوريشن و كلـسيم فـسفات بـهسادگي ترانسفكت نميشوند (18 -16). با توجه به مطالب فـوق،در اين تحقيـق ميـزان ترانسفكـشن مـوقتي 562K بـا تركيـبكاتيونيك 2000Lipofectamine TM در حـد مطلـوب 40% بـودكه به تبع آن ميزان 44% مهار ژن 4TR را داشتيم.
در مجمــوع جهــت حــصول بــه ميــزان بيــشتر از انتقــالمولكولهايsiRNA ، بايد از روشهاي ترانسفكـشن دائمـي بـرپايه لنتيويروس يا موتانتهاي تراريخت بهره گرفت كه در اين صورت ميزان مهار ژن نيز بيشتر خواهد بود (19).

شكل3 : نمونه اي از منحني هاي تكثير مربوط به 4TR و GAPDH از سلول هاي 562K ترانسفكت شده با مولكول هايTR4 siRNA وNegative siRNA.
محور افقي تعداد چرخههاي PCR و محور عمودي مربوط به ميزان افزايش فلورسانس سايبرگرين است. CT مربوط به سلولهاي K562 ترانسفكت شده با negative siRNA براي ژن 4TR، 679/30 و CT براي ژن GAPDH، 643/23 بود. همچنين CT مربوط به سلول هاي K562 ترانسفكت شده با siRNA 4TR براي ژن 4TR، 433/29 و CT براي ژن GAPDH، 675/21 بود. مقادير بدست آمده در فرمول ΔΔCT2 گنجانده شد.

شكل 4: نمونه اي از منحني هاي تكثير مربوط به γ گلوبين و GAPDH از سلول هاي 562K ترانسفكت شده با مولكول هايTR4 siRNA و Negative siRNA.
محور افقي تعداد چرخه هايPCR و محور عمودي مربوط به ميزان افزايش فلورسانس سايبرگرين است. CT مربوط به سلولهـاي 562K ت رانـسفكت شـده بـاnegative siRNA براي ژن گاماگلوبين 758/24 و CT براي ژن GAPDH، 643/23 مي باشد. همچنين CT مربوط به سلول هاي 562K ترانـسفكت شـده بـاTR4 siRNA براي ژن گاماگلوبين 042/23 و CT براي ژن GAPDH، 675/21 بود. مقادير بدست آمده در فرمول ΔΔCT2 گنجانده شد.

نتايج القاي بيان ژن گاماگلوبين نـشان داد كـه بـا توجـه بـهاينكه مهار ژن 4TR به ميزان 44% كاهش داشت ولي افـزايشقابل ملاحظه اي در بيان ژن گاماگلوبين مشاهده نـشد (حـدود18/1 برابر). چندين عامل را ميتـوان در ايـن زمينـه در نظـرداشت. اول اينكه ميزان ترانسفكشن يك عامـل محدودكننـدهاست در نتيجه ميتوان گفت اين فـاكتور رانـدمان مهـار بيـان4TR توسطTR4 siRNA را محدود مـيسـازد . بـا توجـه بـهميــزان ترانسفكــشن pSV-β-Galactosidase در ســلول هــاي 562K مي توان پي برد كه در سيستم راه اندازي شـده در ايـنتحقيق و نيز در تمام سيستمهاي ترانسفكـشن مـوقتي، تمـامجمعيت سلولي 562K مولكولهايTR4 siRNA را بـه طـوريكسان و به يك اندازه دريافت نمي كننـد و ايـن مـي توانـد درميــزان بيــان ژن هــدف 4TR و بــه تبــع آن در القــاي ژنگاماگلوبين اثر مستقيم داشته باشد. البته شـايد بـا راه انـدازيسيستم ويروسي و ايجاد ردههاي سـلولي پايـدار ميـزان مهـاربيان 4TR افزايش يابد و سبب افزايش بيان گاماگلوبين شـود.
بعلاوه گزارشاتTanabe و همكاران نشان داد كه در موشـهايتراريختي كه براي ژنهاي 2TRو 4TR همزمان دابل موتانـتبودند، بيان گاماگلوبين حدود 2 الي 3 برابر بيشتر شده بود كهكمتر از حد انتظار است (11).
با مقايسه نتايج ميتوان پيشنهاد كرد كه بيـان دو ژن 4TR و 2TR بطور همزمان توسط روشRNAi مهار شوند و سـپسالقاي بيان گاماگلوبين بررسي شود.

نتيجه گيري
در اين مطالعه سيـستمRNAi در سـلولهـا ي 562K دارايعملكرد بود و توانست بيان ژن 4TR را در سـلولهـا ي 562K به ميزان 44% كاهش دهد؛ ولي بايد توجه داشت كه مهار بيانژن 4TR به روش RNAi در سلول 562K نمي تواند به تنهاييبيان ژن گاماگلوبين را در حد قابل ملاحظهاي افزايش دهد.

تشكر و قدرداني
بدينوسيله از آقاي پروفسور فرانك گوسولد (Frank Grosveld) از دانشگاه اراسموس هلند سپاسگزاري مـيشـود . همچنـين ازكليه اساتيد و همكـاران در مركـز تحقيقـات ژنتيـك دانـشگاهبهزيستي و توانبخشي كمال تشكر را داريم.
REFERENCES
120784667667



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید