پژوهن ده (سال شانزدهممجله، شماره پژوهشي5آذر ، و پي دي در دانشگاه پي 1390 علوم83 ، پزشكي صفحات شهيد226 تا بهشتي233) تاريختاريخ پذيرشدريافت مقالهمقاله:: 3/1127//4/13901390

تعيين تنوع ژني اشريشياكلي از آب چاه پاركهاي تهران با روش مولتي پلكس PCR
دكتر محمدمهدي سلطان دلالو1 2*، سامان سپهري3، دكتر مصطفي حسيني4، اكرم طباطبايي بفرويي5، دكتر زهرا ديلمي خياباني6

استاد، بخش ميكروب شناسي، گروه پاتوبيولوژي، دانشكده بهداشت، دانشگاه علوم پزشكي تهران
استاد، مركز تحقيقات ميكروب شناسي مواد غذايي، دانشگاه علوم پزشكي تهران
دانشجوي كارشناسي ارشد، دانشگاه آزاد اسلامي، واحد زنجان
دانشيار، گروه آمار و اپيدميولوژي، دانشكده بهداشت، دانشگاه علوم پزشكي تهران
كارشناس ارشد بخش ميكروب شناسي، گروه پاتوبيولوژي، دانشكده بهداشت، دانشگاه علوم پزشكي تهران
استاديار، مركز تحقيقات بيولوژي، دانشگاه آزاد اسلامي، واحد زنجان

چكيده
سابقه و هدف: آب نقش عمدهاي در زمينه بهداشت عمومي داشته و آب آلوده داراي اثرات مستقيم بر سلامت انسان ميباشد. با توجهبه نقش پـر اهميـت اشريـشياكلي هـاي مولـد اسـهال (ETEC, EHEC, EIEC, EPEC) در كودكـان، و كـاربرد روشـهاي فنـوتيپي درآزمايشگاهها، اين سؤال مطرح است كهE.coli هاي شناسايي شده جزو كداميك ازE.coli هاي مولد اسـهال مـيباشـند؟ هـدف از ايـنمطالعه شناخت وضعيت آلودگي ميكروبي آب چاه پاركهاي تهران، و تعيين انواع پاتوتايپ اشريشياكلي هاي مولد اسهال ميباشد.
مواد و روشها: 165 نمونه آب چاه پاركها از 5 منطقـه جغرافيـايي شـمال، جنـوب، شـرق، غـرب و مركـز تهـران در شـرايط اسـتريل نمونهبرداري و جهت بررسي با فيلتر غشايي و تعيين انواع پاتوتايپ هاي E.coli به آزمايشگاه بخش ميكروبشناسي دانـشكده بهداشـتمنتقل گرديد.
يافته ها: نتايج بدست آمده نشان ميدهد كه 90 نمونه (5/54%) از آبهاي تهيه شده آلوده به E.coli بودند. نمونههاي آب چاه در جنوبتهران درصد آلودگي بيشتري نسبت به ساير نقاط داشته است. نتايج تكميلي با مولتي پلكسPCR نشان داد كه از 90 نمونه آلـوده بـهE.coli، تنها 67 سويهDEC جدا شد، كـه بـه ترتيـب 42 سـويه (7/62%) EPEC، 12 سـويه (9/17%) STEC (يـاEHEC )، 9 سـويه(4/13%) به عنوان سويه هاي EIEC و 4 سويه 6(%) به عنوان سويه هاي ETEC شناخته شدند.
نتيجهگيري: حضور پاتوتايپ هاي مختلف در نمونههاي آب چاه پاركها مي تواند بر اهميت اسـتفاده از علائـم هـشداردهنده و آمـوزشمردم بويژه كودكان به هنگام بازي و استفاده از پاركها تأكيد نمايد.
واژگان كليدي: آب چاه، اشريشياكلي، روش شناسايي ژنتيكي، اسهال

لطفاً به اين مقاله به صورت زير استناد نماييد:
Soltan Dallal MM, Sepehri S, Hosseini M,Tabatabaei Bafrouei A, Deilami Khiabani Z. Determination of genotype variation of Escherichia coli in well water of Tehran’s parks by Multiplex PCR. Pejouhandeh 2011;16(5):226-33.

مقدمه1
كلي فرم ها دستهاي از باكتريها هستند كه در روده انـسان وحيوانات خونگرم به تعداد فراوان يافت مي شوند، لذا، بسياري از استانداردهاي غذايي و آب را با تعيـين كلـي فـرمهـاي مـدفوعمـشخص مـي نماينـد ( و1 2). بـارزترين كلـي فـرم مـدفوعي،

* نويسنده مسؤول مكاتبات: دكتر محمد مهدي سلطان دلال؛ بلـوار كـشاورز، خ
16 آذر، دانشگاه علوم پزشكي تهران، دانشكده بهداشـت، بخـش ميكـرو ب شناسـي؛ تلفن: 88992971-21-98+؛پست الكترونيك: [email protected]

اشريشياكلي است كه به عنـوان بخـشي از فلـور ضـروري رودهانــسان، در حفــظ فيزيولــوژي ميزبــان ســالم نقــش دارد. اشريـشياكلي بـه علـت فراوانـي در مـدفوع انـسان و حيوانـات خونگرم، و به دليل اينكه آسانتر از سـاير پـاتوژنهـاي رودهاي قابل تشخيص و تمايز است به عنوان معرف آلـودگي مـدفوعيانتخاب شـده و حـضور آن در آب و مـواد غـذايي نـشاندهندهآلودگي اخيـر آن نمونـه بـا مـدفوع و حـضور احتمـالي سـايرپاتوژن هاي خطرناك ميباشد 3-5(). از بين عوامـل باكتريـاييبيماريزا، اشريشياكلي مولد اسهال (DEC) در اين دستهبنـديجايگاه ويژه اي داشته و يكي از عوامل مهم اسهال اپيـدميك واندميك در جهان ميباشد و (6 7).
اشريشيا كلـيEPEC عامـل عمـده اسـهال نـوزاد انـسان دركشورهاي توسعه نيافته مـيباشـد امـا بـه طـور روزافـزون دركشورهاي توسعه يافته نيز شناسايي مي شـود. EPECبـر روي سطح اپيتليال كلونيزه شده و اثرات بيماريزايي خود را در وهلهاول با اتصال به سطح انتروسيتها اعمـال مـيكنـد و موجـبتغييـرات هي ستوپاتولوژيك م يشـود (810-). اشري شياكلي ETEC شايعترين عامل اسهال در كـشورهاي در حـال توسـعهمي باشد و مسؤول بيش از يك ميليارد مـورد اسـهال در سـال ميباشد، كه 400-300 ميليون آن در كودكان زير 5 سال رخ ميدهد. ETEC شايعترين عامل اسهال مـسافر مـيباشـد و بـاكلونيزه شدن در روده كوچـك و ترشـح دو نـوع توكـسينLT (حساس به حرارت) وST (مقاوم بـه حـرارت) موجـب اسـهالمي شود (13-11). اشريشياكليEHEC در دهه اخير به عنوانعامل اسهال شديد خوني و همچنين كوليت هموراژيك (HC) و سندرم اورميك هموراژيـك (HUS) بـويژه در بـين كودكـانشــناخته شــده اســت . از خــصوصيات اصــليEHEC توليــد وروتوكسينVT1 وVT2 ميباشد. E.coli مولـد وروتوكـسينبه سـروگروپO157:H7 تعلـق دارد كـه اغلـب در ارتبـاط بـا همهگيريهاي گسترده ميباشد. از ويژگـي بـارز ايـن سـويه هـااهميت آنها در عوارض باليني بسيار وخـيم بـويژه در كودكـان مي باشـد (16-14). اشريـشياكلي EIEC قـادر بـه تهـاجم بـهاپيتليوم كولون بوده و گاهي موجب اسهال خوني ( ديـسانتري) مي شود. اين باكتري باعث ديسانتري باسـيلي مـشابه شـيگلوز ميگردد و بيماران داراي تب، كرامپ و مدفوع خوني ميباشند.
علايم بيماري مربوط به توانايي باكتري در اتصال اختصاصي به سلولهاي مخاط روده بزرگ مي باشد (17 و 18).
از آنجايي كه سويههاي DEC از E.coli غير بيماريزا (كـه بـهطور معمول در مدفوع انـسان يافـت مـي شـوند ) قابـل تميـز وجداسـازي نمـي باشـد، نمـ يتـوان تنهـا براس اس معيارهـاي بيوشيميايي و كشت اين سويهها را شناسايي كـرد (19 و 20).
لذا در بررسي نمونههاي آب بـويژه آب آشـاميدني كـه توسـطE.coli آلوده ميشوند، نمي توان بيماريزا بودن و يا نبودن آن راشناسايي نمود . با توجه به نقش پر اهميـت اشريـشياكلي هـاي
مولـد اسـهال (ETEC, EHEC, EIEC, EPEC) در كودكـان (21و 22)، و كاربرد روشـهاي فنـوتيپي در آزمايـشگاهها، ايـنسؤال مطرح است كهE.coli هاي شناسايي شده جزو كداميكازE.coli هاي مولد اسهال مـيباشـند؟ از طرفـي بـ ا توجـه بـهخشكسالي سالهاي اخير و كمبود آب، در حال حاضر بخشي ازآب تهران از چاههاي موجود جبران ميشود. لـذا ايـن مطالعـهگذشـته از شـناخت وضـعيت آب چاههـاي تهـران، بـه دليـل شناخت ميزان و وضعيت انواع اشريشيا كليهاي مولد اسهال درآب چـاه مـي توانـد مفيـد و پاسـخگوي بـسياري از ابهامـات و سؤالات باشد.

مواد و روشها
اين م طالعه از نوع توصيفي بوده و جمعاً 165 نمونه آب چـاهرا بررسـي نمـود. بـراي ايـن منظـور، 33 نمونـه از 5 منطقـه جغرافيايي شمال، جنوب، شرق، غرب و مركزتهران در شـرايطاستريل نمونه برداري و جهـت بررسـي طبـق مراحـل زيـر بـهآزمايشگاه بخش ميكروبشناسـي دانـشكده بهداشـت منتقـلگرديد.
مرحله اول:
1- جداسازي اشريـشيا كلي از نمونـههـاي آب چـاه بـه روشفيلتراسيون (23)
روز اول : ابتدا ظـرف حـاوي نمونـه خـوب تكـان داده شـد و cc 250 از نمونه در شرايط استريل از فيلتر واتمن mm 47 بـا سايز 45/0 ميكرومتر عبور داده شد. سپس با استفاده از پـنساستريل، فيلتر بر روي سطح پليت حاوي محيط مككانكي آگـارقرار داده شد و پليت بـه مـدت 48 -24 سـاعت در دمـاي oC 37 گرماگذاري گرديد.
روز دوم : پس از طي مدت زمان ذكر شـده، پرگن ـههـاي مـورد نظر شمارش شده و در cc100 آب گزارش گرديد. سـپس5 -3 پرگنه از هر پليت بر روي محيط مككـانكي آگـار جهـت انجـامتست افتراقي خالص شد و پليتها به مدت 24 ساعت در دمـايoC 37 گرماگذاري شدند.
روز سوم: پس از خالصسازي، بـراي پرگنـههـاي مـورد نظـرتست هاي افتراقي (SIM ،TSI ،LD، اوره، سـيمون سـيترات و MRVP) انجام شد.
روز چهارم : با توجه به نتايج تستهاي افتراقي ، وجود يا عـدموجود اشريشياكلي تعيين گرديد. سپس پرگنه هاي مربـوط بـهايزوله هايE.coli در 80 – در تريپتي كيز سويبـراث (TSB) و محيط skim milk غني شده با گليسرول نگهداري شـدند، تـادر مراحل بعدي به منظور استخراجDNA ( جهـت تكثيـر بـاروش PCR ) مورد استفاده قرار گيرند.
مرحله دوم:
2-1- استخراج DNA از سويه هاي E.coli: (21)
در ايـن مطالع ه اسـتخراج DNA بـا كيـت اسـتخراج DNA ژنومي خريداري شده از شركت ژنفـن آوران توليـدي شـركتBIONEER انجام گرفت. در اين روش پس از كشت نمونه بـر روي محيط كشت مـولر هينتـون آگـار در دمـايoC 37 و 20 ساعت انكوبه گذاري،810- پرگنه تك E.coli با استفاده از لوپ برداشـته شـد و در 200 ميكروليتـر آب مقطـر دوبـار تقطي ر ديونيزه در تيوبهاي cc 5/1 مخلوط گرديد و با ورتكس با دور2-3 هزار به خوبي همگن شد؛ سـپس براسـاس دسـتورالعمل كيت، استخراج DNA صورت گرفت.
محلول ژنومي كه به ايـن صـورت حاصـل شـده را مـيتـوان
مستقيماً در واكنشPCR مورد استفاده قـرار داد و يـا در oC 4
جدول1: پرايمرهاي مورد استفاده براي تكثير ژنهاي ويرولان پاتوتايپ هاي مختلف
ژن هدف (bp)سايز سكانس پرايمر پاتوتايپ
eae F eae R 91 CTGAACGGCGATTACGCGAA CGAGACGATACGATCCAG EPEC
stx1/stx2 F stx1/stx2 R 518 GAGCGAAATAATTTATATGTG TGATGATGGCAATTCAGTAT EHEC
ipaH F
ipaH R 600 GTTCCTTGACCGCCTTTCCGATACCGTC GCCGGTCAGCCACCCTCTGAGAGTAC EIEC
elt F elt R 450 GGCGACAGATTATACCGTGC CGGTCTCTATATTCCCTGTT ETEC

براي آزمايشهاي بعدي ذخيره نمود. براي ذخيره طولاني مدتبايستي محلول استخراج را درoC 20 – نگهداري نمود چـرا كـهممكن است DNA در معرض هيدروليز اسيدي قرار گيرد.
2-2- انتخاب جفـت پرايمرهـا: جهـت بـسط ژنهـاي مـورد
مطالعه (ipaH ،elt ،stx1/2 ،eae) چهار جفت پرايمر اختصاصي و براي هر ژن يك پرايمـر فـوروارد و يـك پرايمـر ريـورس بـراساس مقالات و منابع موجود انتخاب گرديد و هومولوژي تواليآنها با BLAST مورد بررسي قرار گرفت . در اين مطالعـه بـرايتكثير ژن هاي ويرولان از جفت پرايمرهاي (ژن فن آوران) نـشانداده شده در جدول 1 استفاده شد.

2-3- E.coli شاهد يا نمونه كنترل: در هر سري آزمايش بهمنظور اطمينان از صحت روند كـار و مـواد واكنـشگر از سـويهاستاندارد به عنوان كنترل مثبت اسـتفاده شـد. بـراي كنتـرلمنفي از آب مقطر دو بار تقطير ديونيزه اسـتريل شـده (مـورداستفاده در تمام مراحل كار از جملـه اسـتخراجDNA ، رقيـقسازي پرايمر، واكـنشPCR و…) اسـتفاده شـد تـا اطمينـانبيشتري از صحت آزمايش حاصل گردد. براي كنترل مثبـت از سويه هـاي اسـتاندارد،E.coli ATCC 35218 حـاوي ژن هـايstx1 و E.coli ATCC 7852 ،stx2 حـاوي ژنShigella ،eae sonnei ATCC 9290 حـاوي ژنipaH و يـك ايزولـه بـالينيETEC ح اوي ژنelt .، كه حاوي ژنهاي مـورد مطالعـه بودنـداستفاده شد.
2-4- آماده نمودن مخلوط اصلي واكـنش: جهـت يكنواخـتنمودن شرايط آزمايش و براي كاهش دفعات استفاده از سمپلرو بــاز و بــسته نمــودن درب تيـ ـوبهــا و انتقــال آلــودگي در نمونه هاي مورد آزمايش، مخلوط اصلي واكنش PCR Mixture از قبل تهيه شد. در ابتدا حجم هر واكنش مشخص گرديد كـهدر اين آزمايش حجم واكنش نهـايي (واكـنشUniplex بـرايset نمودن ) 25 ميكروليتر در نظر گرفته شد، چرا كـه بهتـرينتبادل حرارتي در ايـن حجـم انجـام مـي گيـرد . سـپس تعـدادنمونه ها همراه با كنترل منفي و مثبت با احتساب يـك نمونـهبيشتر محاسبه گرديد. به دليل تعداد زياد پرايمرها 4( جفت يا8 عدد ) و همچنين ناهماهنگ بودن دماي ذوب آنهـا، در ابتـدابرايset نمودن كار بـراي هـر سـويه اسـتاندارد يـك واكـنشUniplex انجام گرفت تا از وجود ژن مورد نظر در اين سـويه وهمچنين مراحـل و شـرايط كـار بـه منظـور تـشخيص ايـن ژن،اطمينان كافي حاصل شود. سپس سه ژن 2/1eaeA ،stx وipa H در يك واكنش و ژنelt نيز در يك واكنش جداگانـه (در يـكواكنش Uniplex) مورد برررسي قرار گرفتند.
2-5- روش كار آزمونPCR : نمونه هـايDNA مربـوط بـهسـ ويه هـ اي بـ ـاليني و DNA سـ ـويه هـ اي اسـ تاندارد در ميكروتيوب هاي جداگانه و از هـر كـدام در چنـد ميكروتيـوبتقسيم شد تا در موقع كار با آنها فرايند دفريز (آب شـدن) بـهحداقل رسيده و كارآيي DNAي الگو كاهش نيابد. تيوب هـايمربــوط بــه كيــتPCR ، آب مقطــر ديــونيزه اســتريل وميكروتيوب هاي مربوط به پرايمرها كه قبلاً رقيق شـد ه بـود ، از يخچال بيرون آورده شـد تـا ذوب شـوند. پـس از ذوب شـدنتمامي مواد مصرفي، مخلوطي از مواد واكنش با در نظر گرفتنغلظت نهايي هر يك از مواد تهيه شد.
6858009966198

پس از محاسبه مواد واكنشگر، مواد در تيوب cc 2/0 كه قبلاً شماره نمونه برروي آن نوشـته شـده بـود ريختـه و در نهايـتحجم مخلوط بـه 25 ميكروليتـر رسـانده شـد. در هـر يـك ازتيوب ها ابتدا 5/12 ميكروليتر ازMastermix ، 5/2 ميكروليتـراز coral load و 3 ميكروليت ر از DNAي الگــو ريخت ـه شــد. سپس به مدت 510- ثانيه مخلوط راspin كرده و به هر يـكاز تيوبها 5 ميكروليتر آب مقطر و 1 ميكروليتر از هـر يـك ازپرايمرها اضافه شد. در نهايت مخلـوط آمـاده مجـدداً 5 ثانيـهspin شد. سپس نمونه ها به دستگاه ترمـال سـايكلر (PeQlab) منتقل شده، برنامه مورد نظر وارد شده و دستگاه روشن شد.
2-6- آمـاده سـازي مـاركر انـدازه مولكـولي يـا ladder: ايـن ماركرها در وزنهاي مولكولي متفاوت تهيه شده و پس از رقيـقنمودن و اضافه نمودن رنگ مخصوص به آن استفاده مي شـود .
در اين مطالعهladder بـا اسـتفاده از آب مقطـر اسـتريل (بـهنسبت 5:5:20 ميكروليتر به ترتيب از آب مقطر استريل: رنگ: ماركر) رقيق شد . در هنگام الكتروفورز 5 ميكروليتـر ازladder رقيق شده در يكي از چاهكها load شد.
2-6- الكتروفـورز محـصول PCR: 5 ميكروليتـر از محـصول PCR با الكتروفورز بر روي ژل آگـارز 1% حـاوي 5 ميكروليتـررنگ اتيديوم برومايـد در بـافر تـريس بـورات-TBE) EDTA) X5/0 و با جريان 80 ولـت آشكارسـازي شـد. دو چاهـك بـهنمونه كنترل مثبت و منفي و يك چاهك به ladder اختـصاصيافت. پس ازload نمودن تمامي نمونهها (نمونه هـاي بـاليني، كنتــرل مثبــت و منفــي وladder ) درب تــانكر بــسته شــد،
الكترودهاي مثبت و منفي تـانكر بـه دسـتگاهpower supply متصل گرديد و دستگاه روشن شد. ولتاژ به آرامي بـر روي 80 تنظيم شد و به مدت 90 دقيقه ژل الكتروفورز گرديد.
2-7- مشاهده بانـدهايDNA محـصول و آنـاليز نتـايج ژلالكتروفورز: تعيين هويت باندهاي حاصل به كمـك مقايـسه بـاماركر وزن مولكولي (Ladder) يك كيلوبـاز انجـام شـد. تهيـهعكس از ژل با استفاده از دستگاه ترانس ايلوميناتور (Bio-Rad
در مجاورت Gel Doc™1000 fluorescent imaging system) .نور ماوراي بنفش صورت گرفت

يافته ها
165 نمونه آب چاه پارك از منـاطق مختلـف تهـران مـوردبررسي قرار گرفت كه از اين ميان،90 نمونـه (5/54%) طبـقاستاندارد بين الملليISO (23) و اسـتاندارد ملـي ايـران بـهشماره 1011 (24) غير قابل مصرف بود. نتايج بدسـت آمـدهنشان مي دهد كـه نمونـه هـاي آب چـاه در جنـوب تهـران ازدرصد آلودگي بيشتري نسبت به ساير نقـاط برخـوردار بـودهاست. آزمون كاي دو نشان داد بين مناطق مختلف شـهري ازنظر درصد نمونه هاي غير قابـل مـصرف اخـتلاف معنـي داري وجود دارد (06/0 p<). با توجه به درصد نمونه هاي غير قابلمصرف مشاهده مـي شـود كـه منطقـه شـمال و غـرب دارايآلودگي كمتري نـسبت بـه منـاطق جنـوب و شـرق هـستند
(جدول 2).
مـولتي پلكـس PCR نـشان داد كـه از 90 نمونـه آلـوده بـه E.coli، تنها 67 سويهDEC جدا شد، كه به ترتيب 42 سـويه
(7/62%) EPEC، 12 ســويه (9/17%) STEC (يــا EHEC)، 9 سويه (4/13%) به عنوان سويههايEIEC و 4 سـويه 6(%) بـهعنوان سويه هاي ETEC شناخته شدند (جدول 3 و شكل 1).

بحث
امروزه عليرغم پيشرفت سـريع در علـم و توسـعه بهداشـت،
جامعه مدرن هنـوز از شـيوع بيماريهـايWater- borne رنـجمي برد ( و1 2). روش MFمي تواند تكنيكي مفيد براي اكثريت آزمايـشگاههاي كيفـي آب باشـد (23). اسـتفاده از ايـن روش نسبتاً ساده است، و نمونه هاي بسياري ميتوانند در طـي يـكروز (با توجـه بـه تجهيـزات محـدود آزمايـشگاه) توسـط يـكتكنسين با آموزش مقدماتي و پايه مورد آزمايش قرار گيرند.
همچنين تغييرات زيادي در ارزيـابي هـاي روش فيلتراسـيونغشايي در تستهاي مربـوط بـه كلـي فـرم هـا، كلـيفـرم هـايمدفوعي وE.coli انجام گرفتـه اسـت كـه تعـدادي از آنهـا درآزمايشهاي غذاهايي نظير شير و نوشيدنيها استفاده مي شـوند اما اكثـر آنهـا بـراي آنـاليز آب آشـاميدني، آب چـاه، و آب هـاي محيطي استفاده ميشوند (25 و 26).

جدول2- وضعيت توزيع نمونههاي آب چاه از نظر قابليت مصرف

-33837-97232حضوركلي

مدفوعي

فرم

مصرف

قابل

غير

جغرافيايي

اطق
من

(%)
داد
تع

/4)
39
(
13

حضوركلي

مدفوعي

فرم

مصرف



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید