پژوهنسال ده پان(زدهممجله، شماره مهرپژوهشي4 ، و پي آبان در دانشگاهپ ي 1389علوم76 ، پزشكي صفحات 137شهيد تا 142بهشتي ) تاريختاريخ پذيرشدريافت مقالهمقاله:: 1426/5//4/8889

بررسي ارتباط ژن هاي cagA و cagE موجود در هليكوباكترپيلوري با مشكلات معده در بيماران ايراني
دكتر كاوه بقايي1، ليلا شكرزاده2، فرشته جعفري2، مهدي بلفيون2، دكتر رضا مشايخي3 ، دكتر همايون زجاجي4، دكتر محمدرضا زالي5

محقق، دكتراي زيست شناسي سلولي مولكولي، مركز تحقيقات گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
محقق، كارشناس ارشد ميكروبيولوژي، مركز تحقيقات گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
متخصص پاتولوژي، مركز تحقيقات گوارش و كبد ، دانشگاه علوم پزشكي شهيد بهشتي
استاديار، مركز تحقيقات گوارش و كبد ، دانشگاه علوم پزشكي شهيد بهشتي
-9889224798

استاد، مركز تحقيقات گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
چكيده
سابقه و هدف: هليكوباكتر پيلوري از باكتريهاي مهم بيمـاريزا و يكـي از عوامـل ايجـاد سـرطان معـده در دنيـا محـسوب مـيشـود . بيماريزايي اين باكتري را به طور عمده به جزاير پاتوژنيك موجود در ژنهاي اين باكتري نسبت مي دهند كه شناخته شده ترين ژن ها در اين جزاير، ژنهاي cagA و cagE ميباشند. هدف اين مطالعه، تعيين ارتباط اين جزاير پاتوژنيك با علائـم كلينيكـي در ميـان بيمـارانايراني بوده است.
مواد و روشها: شناسايي هليكوباكتر پيلوري توسط كشت و ژن glmM صورت گرفت. تكثيـر تـواليDNA بـراي دو ژنcagA وcagE به وسيله واكنش زنجيره اي پليمراز (PCR) انجام شد.
يافته ها: از مجموع 311 بيمار مراجعهكننده به بخشهاي گوارش ، 231 بيمار هليكوباكتر پيلوري مثبت گزارش شدند كه از ايـن تعـداد154 (7/66%) مورد باcagA و 90 (39%) مورد با ژنcagE همراه بـود . ارتبـاط معنـيداري ميـان ژن هـايcagA و cagE و تظـاهراتباليني بيماران از جمله گاستريت، زخم معده و سرطان معده به دست نيامد.
نتيجه گيري: ارتباط معني داري ميان ژنهاي cagA و cagE و تظاهرات باليني بيماران به دست نيامد و اين ژن ها به عنوان فاكتورهايي به منظور افتراق منشاء بيماريها تشخيص داده نشدند؛ اين نتايج با نتايج مطالعات قبلي انجام شده در كـشور تطـابق داشـت. همچنـينبرخلاف برخي مطالعات ژن cagA نسبت به ژن cagE به عنوان ماركر بهتري براي cagPAI تشخيص داده شد.
واژگان كليدي: cagE ،cagA، هليكوباكتر پيلوري، اختلالات گوارشي.

لطفاً به اين مقاله به صورت زير استناد نماييد:
Baghaei K, Shokrzadeh L, Jafari F, Bolfion M, Mashayekhi R, Zojaji H, Zali MR. Association between gastric disorders and cagA or cagE in Iranian patients. Pejouhandeh 2010;15(4):137-42.
15407257

مقدمه1
هليكوباكترپيلوري پاتوژن بسيار مهمي براي بيمـاران گوارشـيمحسوب ميشود. در اكثر موارد ايـن بـاكتري باعـث التهابـاتمزمن معدي بدون علائم باليني ميگردد؛ همچنـين مـيتوانـدباعث ايجاد بيماريهـاي جـدي از قبيـل زخـم معـده، مالـت وسرطان معده در برخي افراد گردد (1) .

*نويسنده مسؤ ول مكاتبات: دكتر كاوه بقايي؛ تهران، ولنجك، خيابان يمن،بيمارستان طالقاني، مركـز تحقيقـات گـوارش و كبـد، دپارتمـان اسـهال وبيماريهاي ناشي از غذا؛ پست الكترونيك: [email protected]

اگرچه روند بيماريزايي هليكوباكتر بـه صـورت كامـل شـناخته نشده است اما چندين فاكتور از جملـه جزايـر بيمـاريزاي cag (cag pathogenicity island (cag PAI)) به عنوان عوامل مهم بيماريزايي شناخته شدهاند 2(). جزاير پاتوژنيك ياcagPAI بـااندازه اي در حدود 40 كيلو باز ((Kb سيستم ترشحي تيپIV مربوط به هليكوباكترپيلوري را كد مي كننـ د كـه از طريـق آنپروتئينcagA به داخل سلول ميزبان منتقل مي گـردد و پـس از آن با فسفريله شدن انتهاي ژن cagA (توالي EPIYA) كـهبرروي جزاير پاتوژنيك قرار گرفته، سلول به سـمت بـينظمـيپيش ميرود (3). ژنcagA در بخش فرودست يعني در ناحيهcagI قرار گرفته است و به عنوان ماركري براي اين ناحيـه بـهحساب ميآيد. ارتباط ميان حضور گونههـايcagA مثبـت بـابيماريهاي جدي گوارشي بـه خـصوص در كـشورهاي غربـي وهمچنين كشورهاي آسياي شرقي مانند ژاپـن بـه طـور مكـررگزارش شده است 4-7(). از طرف ديگر، اكثر مطالعـات قبلـيدر ايران ارتباطي ميانcagA و تظاهرات باليني در بيمـاران رانشان نداده اند (813-).
ژنcagE ني ز بر روي ناحيهcagI و در نزديكي ژنcagA قـرارگرفته است و حضور آن براي تحريك ترشحIL-8 از سلولهاي اپيتليال ضروري اسـت 2(). در برخـي مطالعـات ژنcagE بـهعنوان ماركر مناسبتري نسبت بهcagA بـراي ناحيـهcagI وبيماريزاييcagPAI شناخته شده اسـت. همچنـين ايـن ژن راشاخص بهتري براي بررسي روند بيماريزايي هليكوباكترپيلوري دانسته اند (14). اين نتايج نشان ميدهـد كـه نـه تنهـا حـضورcagA بلكه همچنين وجودcagE و بررسـي نقـش آنهـا بـرايدرك رونـد بيمـاريزاييcag PAI ضـروري اسـت، از آنجـا كـهگزارشات زيـادي پيرامـون اهميـت ژن هـايcagA وcagE درايران وجود ندارد، هدف از اين مطالعـه بررسـي ارتبـاطcagA وcagE و تظاهرات باليني در بيماران ايراني است.

مواد و روشها
در فاصله زماني فروردين تا دي ماه 1387، 311 بيمار به دليل مشكلات گوارش ي به بيمارستان طالقاني و مهراد تهران مراجعهكردند كه همگي آنها تحت آندوسـكپي قـرار گرفتنـد و بـرايهمگي آنها فرم اخلاق و فرم جمعآوري اطلاعات تهيه شد . بـراين اساس ، افرادي بـراي ايـن مطالعـه انتخـاب شـدند كـه بـاهليكوباكترپيلوري آلوده بودند و حـداقل تـا يـك مـاه قبـل ازآندوسكوپي دارو مصرف نكرده بودند.
تظاهرات باليني در ميان بيماران شامل زخم معده، گاستريت و سرطان بود . تشخيص زخم معده هنگام آندوسـكوپي و توسـطپزشك متخصص صـورت گرفـت، همچنـين سـرطان و ميـزانشدت گاستريت توسط روشهاي پاتولوژي تـشخيص داده شـد.
سپس به منظـور بررسـيهاي ژنتيكـي و پاتولوژيـك در هنگـامآندوسكوپي نمونه برداري شد كـه در مجمـوع از سـه بيوپـسيگرفته شده از ناحيـه آنتـروم، از دو بيوپـسي بـراي بررسـيهايپاتولوژيك و از يك بيوپسي براي بررسيهاي ميكروبي اسـتفادهشد. دو نمونه گرفته شده براي بررسي پاتولوژي به مـدت يـكشبانه روز در محلول فرمالين قرار داده شد تـا تثبيـت گردنـد.
سپس بـه ضـخامت 3 ميكرومتـر بـرش داده شـدند تـا تحـترنگآميزي هماتوكسيلن – ائوزين قرار گيرند. سپس اين برشهاتوسط دو متخصص پاتولوژي بررسي گرديدنـد. درجـه التهـابمخاط معده، گلاندولار آتروفي و اينتستينال متاپلازيا برحـسبسيستم سيدني تقسيم بندي شدند (15).
جهت بررسي ژنتيك باكتري، نمونه ها در محيط انتقالي شـاملتايوگليكولات با 3/1 گـرم آگـار و 3% عـصاره مخمـر از محـلآندوسكوپي به آزمايشگاه انتقال داده شدند. سپس نمونـههـاي
انتقالي بر روي محيط (Brain Heart Infusion agar (BHI بـا10% خون گوسفند دفيبرينه و همراه بـا مكمـل كمپيلوبـاكتر((Merck Co Humbuerg, Germany كشت داده شدند. پـساز آن پليت هاي كشت داده شده در 37 درجه به مدت 3 تـا7 روز در شـــــرايط ميكروآئروفيليـــــك (Co2 ، %5 O210% و N285%) انكوبه شدند . سـپس بـاكتري مـورد نظـر بـر اسـاستست هاي اكسيداز، كاتالاز و رنگ آميـزي گـرم تـشخيص دادهشد. در نهايتDNA ايـن بـاكتريهـا توسـط كيـت اسـتخرج
Qiagen, Hilden, Germany) QIAamp) استخراج شد و براي تأييد مولكولي باكتري هليكوباكترپيلوري از واكنش زنجيـرهاي پليمراز (PCR) جهت تكثير ژنglmM استفاده شد. همچنين براي شناسايي ژنهايcagA و cagE از تكنيك PCR استفادهشد. پريمرهاي ژنهاي ذكر شـده در جـدول 1 موجـود اسـت(17-16). واكنـشهاي PCR همگـي در حجـم 25 ميكروليتـر انجام شد كه شامل 500 nM ،10 X PCR buffer از هر پرايمر، 200 uM ،2 mM Mgcl2 از هـر1.5 U Taq DNA ،dNTP
polymerase و 200 ng از DNA نمونــه بــود. حجــم نهــايي واكنش با آب مقطر اتوكلاو شده به 25 ميكروليتر رسيد.
شرايط تكثير رشته DNA در دستگاه ترموسايكلر به صورت زير بهينه شد: ذوب اوليه در دماي 95 درجه به مدت 5 دقيقه صورت گرفت، سپس 30 دور شامل دماي ذوب 93 درجه به مدت 1 دقيقه و دماي چسبندگي (Tm) به ترتيب 58، 57 و 63 درجه براي ژنهاي cagE ،glmM ،cagA استفاده شد. همچنين دماي اتساع (extension) به مدت 1 دقيقه و به دنبال آن دماي اتساع نهايي در 72 درجه براي 10 دقيقه دنبال شد. سپس محصول PCR بر روي ژل 2/1% توسط UV مشاهده شد.DNA سويه H. pylori 26695 به عنوان كنترل مثبت براي cagPAI ب ه كار رفت.

شماره 4، پي در پي 76، مهر و آبان 1389 كاوه بقايي و همكاران/ 139 جدول 1- پرايمرهاي به كار رفته در مطالعه حاضر
منابع اندازه محصول PCR* توالي پرايمر (‘3-‘5) نام پرايمر ژن
16 296
GCTTACTTTCTAACACTAACGCGC
GGATAAGCTTTTAGGGGTGTTAGGGG glmM1-R

glmM2-F glmM
16 349 AACAGGACAAGTAGCTAGCC
TATTAATGCGTGTGTGGCTG cagA F1

cagA R1 cagA
17 733 GTTACATCAAAAATAAAAGGAAGCG CAATAATTTTGAAGAGTTTCAAACG cagE F

cagE R cagE
*PCR: Polymerase Chain Reaction

متغيرهايي همچون جنسيت، ميانگين سني و شـيوع ژنهـايcagE ،cagA (مثبت يا منفي) در اين مطالعـه لحـاظ گرديـد. تفاوتهاي آماري در شاخصهاي دموگرافيك در ميان گروههـاي مختلف بيمـاران بـه وسـيله تـستChi-square بررسـي شـد. همچنين ارتباط ميان ژنوتايپ باكتري و تظـاهرات بـاليني بـه وسيله تست هايChi-square وStudent’s-t محاسبه گرديـد. آناليز كليه اطلاعات به وسـيله نـرمافـزارSPSS انجـام شـد. p معني دار براي كليه محاسبات زير 05/0 در نظر گرفته شد.

يافته ها
هليكوباكترپيلوري از 231 بيمار شامل 95 مـرد و 136 زن بـاميانگين سـني 9/43 سـال جـدا شـد . تظـاهرات بـاليني ايـنبيماران شامل 182 مورد گاستريت، 16 مورد دئودنال اولسر، 2 مورد گاستريك اولـسر و 23 مـورد حـضور همزمـان دئودنـالاولسر و گاستريك اولـسر بـود. همچنـين در 8 مـورد سـرطانمعده گزارش گرديد. از آنجايي كـه تعـداد بيمـاران بـا حـضورهمزمان گاستريك و دئودنال اولسر غالب بود و تعداد بيمـاراني كه تنها مبتلا به گاسـتريك اولـسر بودنـد بـسيار كـم بـود ، در تقسيم بندي كليه آنهـا در گـروه افـراد مبـتلا بـه زخـم معـده(PUD) بررسي شدند.
از ميان 231 بيمار هليكوباكترپيلوري مثبت مطالعـه شـده، درمجموع 154 (7/66%) بيمار با سويههـايcagA مثبـت آلـودهبودند (جدول 2). تمامي بيماران مورد بررسي در ايـن مطالعـهبر اساس تظاهرات باليني به سه گروه گاسـتريت، زخـم معـده(PUD) و سرطان معـده(GC) تقـسيم شـدند. از ميـان 182 بيمار مبتلا به گاستريت 127 نفر (7/69%)، از ميان 41 بيمـارمبتلا به زخم معده 22 نفر (6/53%)، و از ميان 8 نفر مبتلا بهسرطان معده 5 نفر (5/62%) با سويههايcagA مثبـت آلـودهبودند. هيچ ارتباط معنيداري بين حضور ژنcagA و تظاهراتباليني (جدول 2) و همچنين ميان تظاهرات باليني بـا سـن وجنس( جدول 3) به دست نيامـد. لازم بـه ذكـر اسـت مـواردگاستريت بر اساس دستاوردهاي پاتولوژي تقسيمبندي گرديـدكه شامل موارد زير بود: -عدم التهاب، كه به صورت No acute
inflammation (Polymorph nuclear cell infiltration) none to mild گـزارش گرديـد، -حالـت ميـاني كـه شـامل chronic inflammation (mononuclear cell infiltration) بود و -عدم آتروفي معدي و يا بينظمي رودهاي، كه به عنـوان
.در نظر گرفته شد mild gastritis
ژن cagE در 39% (231/90) سويه هاي جدا شده از بيماران يافت شد. شيوع ژن cagE در بيماران مبتلا به گاستريت 39% (182/71) و در مبتلايان به زخم معده 9/43% (41/18) بود. همچنين تنها در يك مورد از بيماران مبتلا به سرطان معده اين ژن يافت شد (5/12%). ژن cagE نيز همانند cagA هيچ ارتباط معنيداري را با علائم باليني نشان نداد (جدول 2). همچنين حضور همزمان cagA و cagE در 30 (13%) بيمار گزارش شد.

مجوع
(تعداد: 231) سرطان معده (تعداد: 8) زخم معده (تعداد: 41) گاستريت (تعداد: 182)
154 (%66/7) 5 (%62/5) 22 (%53/6) 127 (%69/7) cagA+
90 (%39/0) 1 (%12/5) 18 (%43/9) 71 (%39/0) cagE+
30 (%13/0) 0 (%0/0) 6 (%14/6) 24 (%13/2) cagA+/cagE+
15 (%6/5) 0 (%0/0) 3 (%7/3) 12 (%6/6) cagA-/cagE+
70 (%30) 5 (%62/5) 6 (%14/6) 59 (%32/4) cagA+/cagE-
47 (%20/3) 2 (%25) 11 (%26/8) 34 (%18/7) cagA-/cagE-
جدول 2 – توزيع بيماران مبتلا به اختلالات گوارشي بر اساس نوع بيماري و حضور ژنهاي محتلف در جزاير پاتوژنيك

جدول 3 – توزيع بيماران مبتلا به اختلالات گوارشي بر اساس نوع بيماري، سن و جنس
429185-3594

گاستريت (تعداد: 182) زخم معده (تعداد: 41) سرطان معده (تعداد: 8)
سن
(%25) 0
(%50)
1(%25)
4 0
(%25) 1 (%25)
(%50)
4 3(%16/6)
5 (%27/7)
8 (%44/4)
2(%11/1)
18 2(%8/6)
9(%39/1)
7 (%30/04)
5 (%21/7)
23 13 (%11/4) 35 (%30/7)
27 (%23/6)
39 (%34/2)
114 6 (%8/8)
18 (%26/4)
21(%30/08)
23 (%33/8) 68 15-30
30-45
45-60
60 > مجموع
مردان زنان مردان زنان مردان زنان

بحث
ژن هـاي موجـود بـر روي cagPAI تن وع بـسيار زيـادي را در سراسر دنيا نشان ميده نـد. گزارشـاتي وجـود دارد كـه تنـوعژنتيكي جزايـر بيمـاريزا را بـر اسـاس فاكتورهـاي جغرافيـاييمختلف و دفاع سيستم ايمني ميزبان در برابر عفونـت طـولانيمدت هليكوباكترپيلوري توجيه مي كند؛ اين تغييـر ژنتيكـي درتغيير فنوتيپي بيماريهاي گوارشي مؤثر اسـت (18). مطالعـاتبه ويژه در كشورهاي اروپايي نشان داده اسـت كـه حـضور ژنcagA با تظاهرات باليني شديد و با كلونيزه شدن اين بـاكتريدر معده افراد همراه است؛ همچنين باكتريهاي حامل اين ژنباعث تحريك بيشتر پاسخهاي التهابي نسبت بـه بـاكتريهـايcagA منفـي م ي ش وند (20-19). امـا از س وي ديگ ر اي نمشاهدات در كشورهاي آسيايي تأييد نشده اسـت، در حاليكـهشيوع ژنcagA در اين كشورها بالاسـت (22-21). همچنـينبر اساس مطالعاتي كه به تازگي در كـره، ژاپـن و چـين انجـامشده است ارتباط ميان بيماريزايي ژن cagA و تظاهرات بالينيمانن د سـرطان معـده پـس از آلـودگي بـا هليكوبـاكترپيلوري مشخص نشده است (23). در اين مطالعه نيـز ارتبـاطي ميـانcagA با علائم باليني در بيماران ايراني به دست نيامد كه البته اين نتيجه با نتايج قبلي گزارش شـده از ايـران هماهنـگ بـود 9(، 13-12). همچنين ساب تايپهاي ژنcagA كه بر اسـاستواليه اي تك راري انته اي آنه ا ب ه دو ف رم ش رقي و غرب يتقسيم بندي مي شوند نيز در شدت بيماريزايي باكتريي مؤثرنـد(25-24)؛ به طوريكه ژنcagA با تكرارهاي بـالاتر تواليهـايانتهايي (تيپ شرقي ) داراي قدرت بيماريزايي بيشتري از تيـپغربي (با تواليهاي كمتر) هستند (24 و 26). از اينرو مطالعـاتبيشتري براي تعيين زيرگونههاي ژنcagA و بررسـي ارتبـاطآن با شدت بيماري در بيماران ايراني كاملا ضروري است.
در مطالعات قبلي، ژنcagE نـسبت بـهcagA مـاركر بهتـريبرايcagPAI گزارش شده است. همچنين در بررسيهاي انجامشده در ژاپن، نقش آن در پيـشرفت بيمـاري مهمتـر ازcagA تشخيص داده شده است (14). اما مطالعه حاضر نشان داد كـهژنcagA همچنان به عنوان ماركر بهتـري بـرايcagPAI بـه حساب مي آيد تاcagE . البته در اين تحقيق ارتباط معنيداري بين حض ورcagE و علائم باليني در بيماران ايرانـي بـه دسـتنيامد كه اين نتيجه با نتايج به دسـت آمـده توسـط محققـيندانشگاه علـوم پزشـكي مازنـدران مـشابهت دارد (27)، بـدينمعني كه ژن مذكور فاكتور مناسـبي بـراي تفكيـك مـشكلاتگوارشي در ميان بيماران ايراني محسوب نمي گردد. همچنـينمطالعه حاضر، حضور همزمـان ژنcagE وcagA را در تعـدادكمي از نمونهها 30 (13%) نشان داد كه خود نشاندهنده عدميكپارچگي جزاير پاتوژنيك در سويههاي جدا شـده از بيمـارانايراني است . از آنجـا كـه در مطالعـات زيـادي (14، 16 و 28) جزاير پاتوژنيك را به صورت كامـل و بـدون حـذف بخـش يـاقسمتي از آن عامل بيماريهاي معده دانستهاند، مي توان يكي ازدلايل عدم بـه دسـت آمـدن ارتبـاط معنـي دار ميـان ژنتيـكهليكوباكترپيلوري و بيماريزايي آن را وجود جزاير پاتوژنيك بـاحذفهاي بخشي (Partial Deletion) آن دانست.

نتيجه گيري
با تو جه به يافتههاي مطالعه حاضر، ارتبـاط معنـيداري ميـانحضور ژنcagA و علائم باليني بيماران بدسـت نيامـد، امـا ازسوي ديگر همچنان ميتوان ژنcagA را ماركر بهتـري بـرايتعيين حضور cagPAI در مقايسه با cagE درسـويه هـاي جـداشده از بيماران ايراني دانست .

تشكر و قدرداني
نويسندگان اين مقاله از ك ليـ ه محققـين دپارتمـان بيماريهـايناشي از غذا و همچنين دپارتمان آمار مركـز تحقيقـات كبـد وگوارش دانشگاه علوم پزشكي شهيد بهشتي به ويژه آقاي دكترپور حسينقلي كمال تشكر و قدرداني را مـي نماينـد. همچنـينلازم به ذكر است مقاله حاضر نتيجه طرح تحقيقاتي به شـماره381 م صوب مركـز تحقيقـات كبـد و گـوارش دانـشگاه علـومپزشكي شهيد بهشتي مي باشد.
شماره 4، پي در پي 76، مهر و آبان 1389 كاوه بقايي و همكاران/ 141

REFERENCES

Suerbaum S, Michetti P. Helicobacter pylori infection. N Engl J Med 2002;347(15):1175-86.
Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, et al. cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc Natl Acad Sci U S A 1996;93(25):14648-53.
Backert S, Selbach M. Role of type IV secretion in Helicobacter pylori pathogenesis. Cell Microbiol 2008;10(8):1573-81.
Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH, et al. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res 1995;55(10):2111-5.
Kuipers EJ, Pérez-Pérez GI, Meuwissen SG, Blaser MJ. Helicobacter pylori and atrophic gastritis: importance of the cagA status. J Natl Cancer Inst 1995;87(23):1777-80.
Nomura AM, Lee J, Stemmermann GN, Nomura RY, Perez-Perez GI, Blaser MJ. Helicobacter pylori CagA seropositivity and gastric carcinoma risk in a Japanese American population. J Infect Dis 2002;186(8):1138-44.
Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for gastric cancer in people with CagA positive or CagA negative Helicobacter pylori infection. Gut 1997;40(3):297-301.
Mansour-Ghanaei F, Abbasi R, Joukar F, Besharati S, Askari-Jirhandeh N. Anti CagA antibody among patients with non-cardia gastric cancer in comparison with non-ulcer dyspepsia in an area with high incidence of gastric cancer. Saudi Med J 2008;29(11):1606-10.
Hussein NR, Mohammadi M, Talebkhan Y, Doraghi M, Letley DP, Muhammad MK, et al. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease. J Clin Microbiol 2008;46(5):1774-9.
Talebkhan Y, Mohammadi M, Mohagheghi MA, Vaziri HR, Eshagh Hosseini M, Mohajerani N, et al. cagA gene and protein status among Iranian Helicobacter pylori strains. Dig Dis Sci 2008;53(4):925-32.
Farshad S, Japoni A, Alborzi A, Hosseini M. Restriction fragment length polymorphism of virulence genes cagA, vacA and ureAB of Helicobacter pylori strains isolated from Iranian patients with gastric ulcer and nonulcer disease. Saudi Med J 2007;28(4):529-34.
Kamali-Sarvestani E, Bazargani A, Masoudian M, Lankarani K, Taghavi AR, Saberifiroozi M. Association of H pylori cagA and vacA genotypes and IL-8 gene polymorphisms with clinical outcome of infection in Iranian patients with gastrointestinal diseases. World J Gastroenterol 2006;12(32):5205-10.
Jafari F, Shokrzadeh L, Dabiri H, Baghaei K, Yamaoka Y, Zojaji H, et al. vacA genotypes of Helicobacter pylori in relation to cagA status and clinical outcomes in Iranian populations. Jpn J Infect Dis 2008;61(4):290-3.
Ikenoue T, Maeda S, Ogura K, Akanuma M, Mitsuno Y, Imai Y, et al. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin Diagn Lab Immunol 2001;8(1):181-6.
Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994. Am J Surg Pathol 1996;20(10):1161-81.
Kauser F, Hussain MA, Ahmed I, Srinivas S, Devi SM, Majeed AA, et al. Comparative genomics of Helicobacter pylori isolates recovered from ulcer disease patients in England. BMC Microbiol 2005;5:32.
Matteo MJ, Granados G, Pérez CV, Olmos M, Sanchez C, Catalano M. Helicobacter pylori cag pathogenicity island genotype diversity within the gastric niche of a single host. J Med Microbiol 2007;56(Pt 5):664-9.
Blaser MJ, Berg DE. Helicobacter pylori genetic diversity and risk of human disease. J Clin Invest 2001;107(7):767-73.
Basso D, Zambon CF, Letley DP, Stranges A, Marchet A, Rhead JL, et al. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology 2008;135(1):91-9.
Gunn MC, Stephens JC, Stewart JA, Rathbone BJ, West KP. The significance of cagA and vacA subtypes of Helicobacter pylori in the pathogenesis of inflammation and peptic ulceration. J Clin Pathol 1998;51(10):761-4.
Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol 1999;37(7):2274-9.
Maeda S, Ogura K, Yoshida H, Kanai F, Ikenoue T, Kato N, et al. Major virulence factors, VacA and CagA, are commonly positive in Helicobacter pylori isolates in Japan. Gut 1998;42(3):338-43.
Li X, Liu W, Xu W, Shi Y, Xiao S. Clinical implications and prevalence of cagA, cagE and cagT genes in the pathogenicity island of Helicobacter pylori strains isolated from Shanghai patients. Chin J Dig Dis 2001;2(3):1336.
Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR. Variants of the 3′ region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases. J Clin Microbiol 1998;36(8):2258-63.
Yamaoka Y, Orito E, Mizokami M, Gutierrez O, Saitou N, Kodama T, et al. Helicobacter pylori in North and South America before Columbus. FEBS Lett 2002;517(1-3):180-4.
Yamaoka Y, El-Zimaity HM, Gutierrez O, Figura N, Kim JG, Kodama T, et al. Relationship between the cagA 3’ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH. Gastroenterology 1999;117(2):342-9.
Shirazi MH, Pourmand MR, Haghshenas MR, Rezaee VA. Prevalence of helicobacter pylori CagE genotypes, in patients with non-ulcer dyspepsia. J Mazandaran Univ Med Sci 2008;18(64):37-43. (Full text in Persian)
Kauser F, Khan AA, Hussain MA, Carroll IM, Ahmad N, Tiwari S, et al. The cag Pathogenicity Island of Helicobacter pylori Is Disrupted in the Majority of Patient Isolates from Different Human Populations. J Clin Microbiol 2004;42(11):5302–8.



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید