پژوهنسال ده چه (اردهمجله م، شمارپژوهشهبهمني ۶ و ، داپاسنشيف نگاددره پعليوم۱۳۸۸ ۷۲ ، پزصشكفحاي تشهي۲۹۹ د تابهشت۳۰۶ ي) تاريختاريخ پدرياذيرش فت مقامقا له:له :۶ /۱۱ /۳ /۹ ۱۳۸۸
۱۳۸۸/
بررسي تنوع ژنتيكي كريپتوسپوريديوم بر اساس آناليز ژنهاي پلي مورف
SSU­rRNA ، COWP و TRAP­C2 در كودكان مبتلا به اسهال در استانهاي تهران و قزوين
دكتر اكبر كشاورز رياضي۱ ، احسان ناظم الحسيني مجرد۲ ، دكتر علي حقيقي۳ ، نيلوفر تق يپور ۴ ، نويد صاح باختياري۲ ، زهرا نوچي۲ ، دكتر بهرام كاظمي ۵
۱ . مسئول فني، مركز تحقيقات آزمايشگاهي۶۶۰ نزاجا، اداره بهداشت و درمان نيروي زميني ارتش جمهوري اسلامي ايران
۲ . كارشناس ارشد، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
۳ . دانشيار، گروه انگ لشناسي و قارچ شناسي، دانشكده پزشكي، دانشگاه علوم پزشكي شهيد بهشتي
۴ . كارشناس ارشد، گروه انگ لشناسي و قارچ شناسي، دانشكده پزشكي، دانشگاه علوم پزشكي شهيد بهشتي
-9143206418

۵ . استاد، مركز تحقيقات بيولوژي سلولي مولكولي، دانشگاه علوم پزشكي شهيد بهشتي چ ك يده
سابقه و هدف : كريپتوسپوريديوم ت كياخته اي با انتشار جهاني و به عنوان يكي از عوامل مهم اسهال در كودكان و افـر اد داراي نقـص سيستم ايمني شناخته شده است . عمده تحقيقات انجام گرفته در خصوص اين انگل در ايران به بررسـي شـيوع آن در جوامـع مختلـف پرداخته است . هدف از اين مطالعه تعيين تنوع ژنتيكي كريپتوسپوريديوم در كودكان مبتلا به اسهال بر اساس آناليز ژنهـاي پل ـيمـورف SSU­rRNA ، COWP و TRAP­C2 با استفاده از تكنيك PCR­ RFLP مي باشد .
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

مواد و رو شها : در اين مطالعه مقطعي، طي دو سال (آذر ماه۱۳۸۴ تا فروردين ماه ۱۳۸۷ ) ، نمونه هاي مدفوع از۱۲۶۳ كودك مبتلا به اسهال كه به بيمارستانهاي كودكان استانهاي تهران و قزوين مراجعه كردند ، جم عآوري شد . با مشاهده لام مستقيم، فرمل اتر و رنگ آميزي اسيدفاست اصلاح شده ، بررسي لازم جهت شناسايي عوامل انگلي صورت گرفت . در نهايت بر روي DNA استخراج شده از اي زولهها، PCR­RFLP انجام شد .
يافته ها: از مجموع۱۲۶۳ نمونه مدفوع،۳۱ ايزوله با استفاده از روشهاي مستقيم و رنگ آمي ز يهاي تخصصي كريپتوسپوريديوم تشخيص داده شدند، كه از بين آنها پس از بررسي هاي مولكولي۲۵ ايزوله كريپتوسپوريديوم پارووم،۵ ايزوله كريپتوسپوريديوم هومينيس و يك ايزوله هردو ژنوتيپ را نشان داد كه نتايج در هر سه ژن يكسان بوده است .
نتيجه گيري : هر دو ژنوتيپ انساني و گـاوي در كودكـان مبـتلا بـه اسـهال ديـده مـي شـود ولـي بـا توجـه بـه ايـن كـه گونـه غالـب ، كريپتوسپوريديوم پارووم مي باشد ، انتقال زئونوز شايعتر از انتقال انساني بوده و تماس با دام بخصوص گوساله به عنوان مهمتـرين منبـع آلودگي انساني به شمار مي رود .
واژگان كليد ي: تنوع ژنتيك ي، كريپتوسپوريديوم،كودكان مبتلا به اسهال

مقدمه۱
كريپتوســپوريديوم يــك عامــل بيمــاريزاي روده اي مهــم بــا پراكندگي گـسترده در دامهـاي جـوان و انـسان اسـت ( ۱ ) . بـا ظهور پاندمي ايدز در دهه۱۹۸۰ بود كـه ايـن تـ كياختـه بـه عنوان يكي از عوامل مهم مرگ و مير در بيمـاران دچـار نقـص ايمني و يكي از عوامل اسهال كودكـان اهميـت جهـاني يافـت
( ۲ و ۳ ) .
يك معضل بزرگ در درك انتقـال عفونـت كريپتوسـپوريديوم ، نبـودن خـصوصيات مو رفولـوژي واضـح در افتـراق يـك گونـه كريپتوسپوريديوم از ديگر گونه هاست .همچنـين مـشكلات در
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

۰۰۳
تشخيص باعث سـردرگمي در تاكـسونومي كريپتوسـپوريديوم ش ده است . اگر چه آناليز سكانس DNA نشان مي دهد كه ايـن جنس پيچيده بوده و داراي بـيش از۱۸ گونـه متفـاوت اسـت ، شناخت ژنوتيپ هاي متنوع در نمونه هاي ب ه دست آمده از نقاط مختلـف جهـان ، يـك راه قطعـي بـراي بررسـي اپيـدميولوژي كريپتوسپوريديوم است . اين اطلاعات دانـش مـا را از چگـون گي انتشار و وقـوع آلـودگي توسـط گونـه هـاي انـساني و حيـواني افزايش ميدهد ( ۴ و ۵ ) . در ايران بر اسـاس روشـهاي مولكـولي مطالعات محدودي انجام گرفته است كـه دو مطالعـه معمـار و همكاران در سال۲۰۰۶ در افراد HIV مثبت و منفي و مطالعه پيرستاني و همكاران در سال۲۰۰۸ در شهريار در انسان و گاو از آن جمله است ( ۶ و ۷ ).
در مطالعه حاضر بـا اسـتفاده از تكنيـكPolymerase Chain Reaction­ Restriction Fragment Length Polymorphism يا PCR­ RFLP كه يـك روش بـسيار كارامـد ، نـسبتابتاً سـاده و به صرفه مي باشد، تنوع ژنتيكي كريپتوسـپوريديوم در كودكـان مبتلا به ا سهال با توجه به آنـاليز ژنهـاي پل ـــ يمـورف شـامل ( SSU­ ) ، Cryptosporidium Oocyst Wall Protein (COWP small subunit ribosomal RNA (rRNA و (TRAP­ Thrombospondin Related Adhesive Protein C2 ( C2 در فاصله زماني آذر ماه۱۳۸۴ تا فروردين ماه۱۳۸۷ مورد بررسـي قرار گرفت .
موا د و رو شها
نمونه هاي انساني از كودكان مبتلا به اسهال كه بـه بيمارسـتان كودكان دانشگاه علوم پزشكي شهيد بهـشتي و تهـران و مركـز طبي كودكان قـزوين مراجعـه كـرده بودنـد، اخـذ گرديـد . در بررسيهاي انگل شناسي ، پس از انتقال نمونه ها به آزمايـشگاه بـا يكي از روشـهاي مـستقيم، تغلـي ظ ( فرمـالين – ا تـر) گـسترش نازكي از نمونه روي لام تهيه شد و با رنـگ آميـزي اسيدفاسـت ذيل نيلسون رنگ آميزي و با عدسي X۴۰ بررسـي و بـا X۱۰۰ از نظـر وجــود اووسيــست كريپتوسـپوريديوم بررســي شــد و نمونه هاي مثبت در محلـول دي كرومـات پتاسـيم۵ /۲ % در۴ درجه سانتيگراد نگهداري شد ند .
براي استخراج DNA با روش كيت DNA Zol ، بافر DNA Zol (Invitrogene ,Cat. No 10503­027.USA) كـه بـه صـورت محلول آماده براي استخراج DNA ژنوميك از نمونه هاي جامـد و مايع حيوانات، گياهان، قارچ، باكتري و انگل ميباشـد، مـورد استفاده قرار گرفت . اين محلول حاوي گو ان يدين اسـت . فراينـد جداسازي شامل ليز نمونه هاي بيولوژيك در محلول DNA Zol بود و سـپس DNA ژنوميـك بـا اتـانول رسـوب داده شـد . در جريان شستشو با اتانول، DNA در آب يا NaOH۸ مي ل يمولار حل شد .
جهت انجـام nested PCR بـراي ژن SSU­rRNA از دو جفـت پرايمر استفاده شـد (جـدول۱ ) ( ۱۰ ). جفـت پ رايمـر اول يـك فراگمنت kb۳ /۱ از ژن SSU­rRNA را تكثير كرد و محـصول PCR اول به عنوان الگو در دور دوم PCR مـورد اسـتفاده قـرار گرفت، در اين مرحله از جفت پرايمر دوم استفاده شد كه يـك قطعه (bp۸۶۴ – ۸۲۶ ) را بسته به نوع گونه تكثير نمود . واكنش زنجيره پليمراز، با شرايط زيـ ر و بـه تعـداد۳۲ سـيكل صـورت گرفـ ت: دناتوراسـيون اوليـه۳ دقيقـه۹۴ درجـه سـانتيگراد، دناتوراسيون۴۵ ثانيه۹۴ درجه سانتيگراد، آنيلينـگ۴۵ ثانيـه۵۵ درجه سانتيگراد، طويل شدن۶۰ ثانيه۷۲ درجه سـانتيگراد
، طويل شدن نهايي۷ دقيقه۷۲ درجه سانتيگراد . در PCR دوم فقط دماي annealing از۵۵ درجه بـه۵۸ درجـه تغييـر داده شـد و بـه جـاي DNA از محـصول PCR اول و از پرايمرهـاي داخلي استفاده شد .
براي انجام nested PCR با ژن ( TRAP­C2) همانند روش قبل از دو جفت پرايمر استفاده شـد ( ۱۱ ) . جفـت پرايمـر اول يـك قطعه bp ۳۶۶ و جفت پرايمر دوم يك قطعه bp۲۶۶ را تكثيـر كرد . واكنش زنجيره پليمـراز، بـا شـرايط زيـر و بـه تعـداد۳۰ سيكل صورت گر فت: دناتوراسـيون اوليـه۳ دقيقـه۹۴ درجـه ســانتيگراد، دناتوراســيون۴۵ ثانيــه۹۴ درجــه ســانتيگراد، آنيلينگ۴۵ ثانيه۵۴ درجه سانتيگراد، طويـل شـدن۶۰ ثانيـه۷۲ درجه سانتيگراد، طويل شـدن نهـايي۷ دقيقـه۷۲ درجـه سانتيگراد . در PCR دوم فقط دمـاي annealing از۵۴ بـه۵۶ درجه تغيير داده شد و به جاي DNA از محـصول PCR اول و از پرايمرهاي داخلي استفاده شد .
براي انجام nested PCR با ژن COWP هم اننـد دو روش قبـل از دو جفت پرايمر استفاده شده است ( ۱۲ ). جفـت پرايمـر اول يـك قطعـه bp۷۶۵ از ژن COWP و جفـت پرايمـر دوم يـك قطعه bp۵۵۳ را ت كثير نمود . واكنش زنجيره پليمراز ، با شرايط زير و به تعداد۳۰ سيكل صورت گر فت: دناتوراسـيون اوليـه۳ دقيقه۹۴ درجه سانتيگراد، دناتوراسـيون۴۵ ثانيـه۹۴ درجـه سـانتيگراد ، آنيلينـگ۴۵ ثانيـه۵۲ درجـه سـانتي گراد، طويـل ش دن۶۰ ثانيه۷۲ درجه سانتيگراد، طويل شدن نهايي۷ دقيقـه۷۲ درجه سانتيگراد . در PCR دوم فقـط دمـاي annealing از
۵۲ به۵۶ درجه تغيير داده شد و در اين جا به جـاي DNA از محصول PCR اول و از پرايمرهاي داخلي استفاده شد.
جدول۱ – ترادف توالي پرايمرهاي تشخيصي كريپتوسپوريديوم
نام پرايمرها ترادف از َ۵ به ´۳
SSU­rRNAC1F1 5´TTCTAGAGCTAATACATGCC 3´
SSU­rRNA C1R1 5´CCCATTTCCTTCGAAACACGA 3´
SSU­rRNA C2F2 5´GGAAGGGTTGTATTTATTAGATAAG 3´
SSU­rRNA C2R2 5´CTCATAAGGTGCTGAAGGAGTA 3´
TRAP C1F1 5´CATATTCCCTGTCCCTTGAGTTGT 3´
TRAP C1R1 5´TGGACAACCCAAATGCAGAC 3´
TRAP C2F2 5´GGTAATTGGTCACGA 3´
TRAP C2R2 5´CCAAGTTCAGGCTTA 3´
EX­COWP­C1F1 5´TGTCCTCCAGGTACTACA 3´
EX­COWP­C1R1 5´ACCTGTTCCCACTCAATG 3´
Cry­15 5΄GTAGATAATGGAAGAGATTGTG 3΄
Cry­9 5΄GGACTGAAATACAGGCATTATCTTG 3΄
و اطمينان از تكثير قطعه مـورد نظـ ر PCR جهت بررسي نتايج الكتروفورز بـر روي ژل آگـارز و رنـگ آميـزي بوسـيله اتيـديوم برومايد استفاده شد . وزن مولكولي قطعه مورد نظر در كنار يك مـاركر مـشخص گرديـد ( ۱۳ ). جهـت تعيـين گونـه و DNA از SSU­rRNA ژنوتيــپ هــاي كريپتوســپوريديوم توســط ژن RsaI از آنــزيم COWP بــراي ژن ، Vsp­I ، Ssp­I آنزيمهــاي BstEП ، HaeШ از آنــزيم TRAP­C2 و بــراي ژن (GT/AC) بــراي ژنوتيــپ انــساني و HaeШ اســتفاده شــد، كــه آنــزيم – ۲۱) براي ژنوتيپ گاوي جايگاه ش ناسـا يي دارد BstEП آنزيم
د كتر۳۰۱
۱۰ ). جهت بررسي ، نتايج ب ر روي ژل۲ /۳ % مخلوط بـا اتيـديوم برومايد و در كنار ماركر ، الكتروفورز گرديد ( ۱۳ ). جهـت انجـا م RFLP مخلوط اصـلي (Master mix) را از مجمـوع µl۲ بـافر، µl۵ محصول PCR وU۱ از آنزيم را در حجم µl۲۰ رسانيده بـه مدت يك شبانه روز در بن ماري۳۷ درجه قرار داده شد . سـپس۵ ميكروليتر از محصول روي ژل۲ % مخلوط با اتيديوم برومايد الكتروفورز شد و باندهاي مـورد نظـر در كنـار مـار كرDNA بـا دستگاه ترانس ايلوميناتور مشاهده شدند .
ي افتهها
از مجموع۱۲۶۳ كودك مبتلا به اسهال (۷۴۹ پسر و۵۱۴ د ختر) كه مورد بررسي قرار گرفتند ،۳۱ نفر (۵ /۲ %) از نظر اووسيست كريپتوسپوريديوم مثبت ارزيابي شد ند . از اين تعداد به ترتيب۱۶ م ورد از گروه مذكر و۱۵ مورد از گروه م ؤنث آلوده به كريپتوسپوريديوم بودند . از مجموع نمونه هاي جمعآوري شده تعداد۴۶۹ نمونه از استان قزوين و تعداد۷۹۴ نمونه از استان تهران گرفته شد كه به ترتيب۱۲ و۱۹ مورد آلوده به كريپتوسپوريديوم بودند .
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

تمام ايزوله هاي انساني ب ا اين سه ژن با نتايج مثبت همراه بودند . پرايمرهاي ب ه كار رفته توانستند قطع هاي در حدود bp۸۵۱ -۸۲۶ بسته به نوع گونه براي ژن SSU­rRNA ، قطعه اي در حدود bp۵۵۳ براي ژن COWP و قطعه اي در حدود bp۲۶۶ براي ژن TRAP­C2 تكثير نمايند . از۳۱ ايزوله انساني مورد بررسي،۲۵ ايزوله ژنوتيپ گاوي كريپتوسپوريديوم پارووم (C. parvum) ،۵ ايزوله ژنوتيپ انساني (C. hominis) و يك ايزوله عفونت همزمان با هر دو ژنوتيپ را نشان داد ( شكلهاي
۱ تا۵ ).

شكل۱ – الكتروفورز۵ ميكروليتر از محصول nested PCR بر روي ژل آگارز۲ /۳ % توسط ژن TRAP­C2 ( ستون ۱ و۱۱ : DNA ماركر bp۱۰۰ ، ستون۹ – ۲ : نمونه مثبت كريپتوسپوريديوم با پرايمرهاي TRAP­C2 ، ستون۱۰ : كنترل منفي (D.W)
۳۰۲

شكل۲ – الكتروفورز۵ ميكروليتر از محصول nested PCR بر روي ژل آگارز۲ /۳ % توسط ژن COWP (ستون ۱ و۱۳ : DNA ماركر bp۱۰۰ ، ستون
۱۱ – ۲ : نمونه مثبت كريپ توسپوريديوم با پرايمرهاي COWP ، ستون۱۲ : كنترل منفي (D.W )

1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

شكل۳ – الكتروفورز۵ ميكروليتر از محصول nested PCR توسط ژن SSU­rRNA بر روي ژل آگارز۲ % (ستون ۱ و۱۷ : DNA ماركر bp۱۰۰ ، ستون۱۵ -۲ : نمونه مثبت كريپتوسپوريديوم با پرايمرهاي SSU­rRNA ، ستون۱۶ : كنترل منفي ( D.W ).
bp۴۴۹ ،۲۶۸ و۱۱۱ -۱۰۸ مي باشد . در حالي كه الگوي آن با آنزيم Vsp­I متفاوت بوده و در كريپتوسپوريديوم پارووم داراي باندهاي bp ، ۶۲۸ bp۱۰۴ و bp۱۱۶ بوده در حالي كه در كريپتوسپوريديوم هومنيس داراي باندها يbp ، ۵۶۱ bp۱۱۶ ، bp۱۰۴ و bp۷۰ مي باشد . شكل۴ ، الگوي برش محصول nested PCR ژن SSU­rRNA را در اي زولههاي انساني با آنزيم A ) Ssp­I ، (B ) VspI) و شكل۵ الگوي برش محصول nested PCR ژن COWP در اي زولههاي انساني را با آنزيم RsaI نشان ميدهد . همانطور كه در تصوير مشخص است، الگوي برش ژنوتيپ هاي ا نساني و
گاوي كريپتوسپوريديوم پارووم با آنزيم Ssp­I داراي باندهاي

شكل۴ – الگوي برش محـصول nested PCR ژن SSU­rRNA در ايزو لههاي انساني با آنزيم B) VspI )و A) Ssp­I )
(A : ستون ۱ و۹ : ماركر DNA ، ستون۸ – ۲ : نمونه مثبت كريپتوسپوريديوم پارووم با آنزيم B ، Ssp­I : الگوي برش محصول PCR دوم ژن SSUrRNA رابا آنزيم VspI: ستون ۱ و۹ ماركر DNA ، ستون۲ ،۳ ،۶ و۸ نمونه مثبت كريپتوسپوريديوم پارووم، ستون۵ و۷ نمونه مثبت كريپتوسپوريديوم هومنيس، ستون۴ عفونت همزمان از هردو ژنوتيپ)
د كتر ۳۰۳

شكل۵ – الگوي برش محصول nested PCR ژن COWP در ايزو لههاي انساني را با آنزيم RsaI (ستون۱ و۱۲ ماركر DNA ، ستون۲ ،۷ -۴ و۹ نمو نه مثبت كريپتوسپوريديوم پاروم، ستون۳ ،۸ و۱۱ : نمونه مثبت كريپتوسپوريديوم هومنيس ،ستون ۱۰ : عفونت همزمان از هر دو گ ونه)
1572768-1492732 شكل۶ – الگوي برش محصول nested PCR ژن TRAP­C2 در ايزوله انساني با آنزيم HaeaIII و BstEII (آنزيم HaeaIII براي ژنوتيپ انساني و BstEII براي ژنوتيپ گاوي جايگاه دارد ؛ ستون شماره۱ ،۶ -۴ و۸ كريپتوس پوريديوم پارووم ،ستون شماره۲ و۳ كريپتوسپوريديوم
هومنيس، ستون شماره۷ عفونت همزمان ،ستون شماره۹ ماركر DNA)
كريپتوسپوريديوم پارووم براي آنزيم RsaI داراي دو جايگاه برش ميباشد كه پس از هضم انزيمي قطعاتي به طول bp۴۱۳ ،۱۰۴ و۳۴ را توليد مي كندكه پس از الكتروفورز باندهاي bp۴۱۳ و۱۰۴ قابل رؤ يت است . كريپتوسپوريديوم هومنيس براي آنزيم RsaI داراي۳ جايگاه برش ميباشد كه پس از
هضم آنزيمي قطعاتي به طول۲۸۵ ،۱۲۹ ،۱۰۴ و۳۴ را توليد مي كند كه پس از الكتروفورز باند هاي۲۸۵ ،۱۲۹ ،۱۰۴ قابل ر ؤيت است ( شكل ۶ ) .
بحث
كريپتوسپوريديوزيس يك بيماري با انتشار جهاني است و يكي از چهار پاتوژن مهم عامل اسهال در كودكان بوده كه به عنوان يكي از مشكلات عمده بهداشتي مطرح است ( ۲ ). امروزه در اكثر نقاط جهان تحقيقات گسترده اي بر روي خصوصيات مختلف كريپتوسپوريديوم از جمله بيولوژي، اپيدميولوژي و تشخيص آن انجام گرفته است . در كشور ما اكثريت مطالعات انجام گرفته بر روي جنبه هاي اپيدميولوژي انگل معطوف بوده و مطالعات محدودي در زمينه م ولكولي انجام گرفته است . لذا اين بررسي با هدف تعيين گونه ها و ژنوتيپ كريپتوسپوريديوم در كودكان مبتلا به اسهال انجام شد تا اطلاعات دقيقتري در مورد اپيدميولوژي، كنترل و پيشگيري از اين انگل ب ه دست آيد.
در اين بررسي مجموعاً۱۲۶۳ نمونه مدفوع اسهالي از كودكان مبت لا به اسهال كه به مراكز طبي كودكان استان تهران و قزوين مراجعه كردند در طي مدت۲ سال جمعآوري و مورد بررسي قرار گرفت . از ميان اين تعداد نمونه ، نتيجه آزمايش مدفوع۳۱ نفر از آنها از نظر اووسيست كريپتوسپوريديوم با استفاده از روش ميكروسكوپي مثبت بود، بنابراين مي توان شيوع كريپتوسپوريدوزيس را۵ /۲ % گزارش نمود، اين ميزان از شهرهاي اهواز و غرب تهران بيشتر بوده ولي از ساير مناطق مورد مطالعه كمتر مي باشد (۱۸ – ۱۴ ).
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

نتايج اين مطالعه نشان مي دهد كه از ميان۳۱ ايزوله مورد بررسي در كودكان مبتلا به اسهال، تعداد۲۵ ايزوله (۶ /۸۰ %) ژنوتيپ گاوي كريپتوسپوريديوم پارووم (C. parvum) ،۵ ايزولـ ه (۱ /۱۶ %) ژنوتيپ انســ اني كريپتوسپ ـــ وريديوم پارووم ( C. hominis) و يك ايزوله عفونت همزمان از هردو ژنوتيپ را نشان داده است .
نتايج اين مطالعه نشان ميدهد كه ژنوتيپ گاوي كريپتوسپوريديوم پا رووم گونه غالب در كودكان مبتلا به اسهال در اين مطالعه بوده است .با توجه به محدود بودن تنوع ميزباني كه مي توانند به ژنوتيپ انساني مبتلا شوند و به عنوان مخزن عمل نمايند، يافته فوق چندان دور از انتظار نيست .
جدول۲ – فراواني ژنوتيپ انساني و ژنوتيپ گاوي كريپتوسپوريديوم در انسان در مطالعات مختلف
Location No. of isolates C.hominis C.parvum Transmission Pattern Reference
UK 1705 (45637.8%) 1049 (61.5%) Zoonotic 19
Australia 36 30 (83%) 6 (17%) Anthrponotic 23
Japan 20 14 (%70) 3 (15%) Anthroponotic 25
Kuwaite 62 3 (5%) 59(94%) Zoonotic 20
Lima,Peru 127 91 (71.7%) 16(12.6%) Anthroponotic 27
France 47 18 (38%) 29(62%) Zoonotic 21
Kenya 175 (35187%) 15(9%) Anthroponotic 26
Switzerland 9 2 ()%2.22 7 ()%7.77 Zoonotic 22
Uganda 72.8% 18.4% Anthroponotic 29
Iran 17 4 (24%) 13 (76%) Zoonotic 6
The Netherlands 91 64 (70) 18(19%) Anthroponotic 24
England 2414 1005 (41.7%) 1354(56.1%) Zoonotic 28
Iran 24 7 ()%1.92 17(70.8%) Zoonotic 7
در جدول۲ يافته هاي چند مطالعه از نقاط مختلف جهان نش ان داده شده است . يافته هاي مطالعه حاضر با پاره اي از
۴۰۳
برر سيهاي صورت گرفته مشابه بوده ولي با بعضي از نتايج ديگر همخواني ندارد .
در اين بررسي ژنوتيپ گاوي كريپتوسپوريديوم پارووم گونه غالب بوده كه الگوي ژنوتيپ بدست آمده با كشور ها يي مثل انگلستان۵ /۶۱ % ( ۱۹ ) ، كويت۹۴ % (۲۰ ) ، فرانسه۶۲ % ( ۲۱ ) ، سويس۷۷ % ( ۲۲ ) و دو مطالعه در ايران۷۶ % ( ۶ ) ،۷۰ % (۷ ) همخواني داشته است . درحالي كه در كشور هايي مثل استر اليا۸۳ % (۲۳ ) ، هلند۷۰ % ( ۲۴ ) ، ژاپن۷۰ % (۱ ) ، كنيا۸۷ %( ۲۵ ) ، پرو۷ /۷۱ % ( ۲۶ ) و تعداد ديگري ژنوتيپ انساني كريپتوسپوريديوم پارووم غالب بوده است .
معمار و ه مكاران د ر سال۲۰۰۶ به بررسي گونه ها و ژنوتيپ هاي كريپتوسپوريديوم در افراد HIV مثبت و HIV منفي ، با استفاده از روش PCR­RFLP و نواحي هدف ژن 18SrRNA ، پرداخته و نتايج اين مطالعه نشان مي دهد كه از
۱۷ ايزوله مورد بررسي۱۳ ايزوله (۷۶ %) كريپتوسپوريديوم پارووم و۴ اي زوله كريپتوسپوريديوم هومينيس بوده است (۶ ).
تفاوت در منبع عفونت يكي از مهمترين عوامل تفاوت در انتقال ژنوتيپ هاي كريپتوسپوريديوم مي باشد . ب ه طوري كه در كشور ها يي كه كريپتوسپوريديوم هومينيس غالب است ، انتقال از راه آب مهمترين منبع آلودگي به شمار ميآيد ولي در ك شور ما و برخي از كشورهاي اروپا يي و كويت غالب بودن كريپتوسپوريديوم پارووم در نتيجه انتقال زئونوز مي باشد
( ۲۸ و ۲۷ و۱ ۲و۱۹ ) .
Mclauchlin و همكاران در سال۲۰۰۰ با اسـتفاده از تكنيـك
PCR­RFLP و تارگت COWP به بررسي آناليز مولكولي گونـه كريپتوسپوريديوم در۱۷۰۵ نمونه انس اني و۱۰۵ نمونـه گـاوي در انگلستان پرداختند . در اين مطالعه۵ /۳۷ % ژنوتيـپ نـوع۱ ( انسا ني) و۵ /۶۱ % ژنوتيپ نوع۲ ( گـاو ي) و۳ /۰ % ژنوتيـپ نـوع
C. meleagridis را نشان داد ( ۱۹ ). Elwin و همكاران در سال۲۰۰۱ با استفاده از تكنيـك ­PCR RFLP و اســتفاده از ژن TRAP­C2 و آنــاليز هــضم آنزيمــي RFLP يك روش ساده و حساس را براي تأي يـد تنـوع ژنتيكـي ايزوله هاي كريپتوسپوريديوم ب ه كار بردند . TRAP­C2 يك ژن بسيار خوب براي اثبات طبيعت پلي مورفيك ايـن انگـل اسـت . اين روش هم چنين براي ت أييد كريپتوسپوريديوم در نمونه هاي غير از مدفوع مثل لاواژ برونش در بيم اران با سـركوب سيـستم ايمني مبتلا به عفونت ريوي در جريان پيوند مغز استخوان وبد استفاده ميشود ( ۲۹ ) .
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

در سال۲۰۰۱ Xiao و همكارانش۵ گونه كريپتوسپوريديوم را در كودكان شهر ليماي پرو با روش PCR­RFLP برروي ژن SSU­rRNA تشخيص دادند . آنه ا در اين تحقيق نتايج زير را ب ه دست آوردند: گونه هاي زئونوز كريپتوسپوريديوم مثل كريپتوسپوريديوم فليس، كريپتوسپوريديوم مله اگريديس و كريپتوسپوريديوم كنيس مي توانند كودكان HIV منفي را نيز آلوده كنند . گونه هاي زئونوز همانند گونه انساني در۲۸ تا۳۳ درصد موارد باعث اسهال ميشوند . طول دوره اس هال در برخي از كودكان بيش از يك هفته و بيشتر در كودكان زير۳ سال بوده است ( ۲۶ ).
نتيجه گيري
اكثريت عفونت انساني توسط دو گونه كريپتوسپوريديوم پارووم و كريپتوسپوريديوم هومنيس ايجاد ميشود . كريپتوسپوريديوم هومنيس فقط در انسان بيماريزااست در حالي كه كريپتوسپوري ديوم پارووم انسان و ساير پستانداران را مبتلا مي كند . نتايج اين مطالعه نشان ميدهد كه هر دو ژنوتيپد كتر ۳۰۵ انساني و گاوي د ر كودكان مبتلا به اسهال ديده ميشود ولي با توجه به اين كه گونه غالب كريپتوسپوريديوم پارووم مي باشد بنابراين انتقال زئونوز شايعتر از انتقال ان ساني بوده و تماس با دام بخصوص گوساله به عنوان مهمترين منبع آلودگي انساني به شمار مي رود .
1207008111815

REFERENCES
Yagita K, Izumiyama Sh, Tachbana H, Masuda G, Iseku M, Furuya K, et al. Molecular characterization of Cryptosporidium isolates obtained from human and bovine infections in Japan. Parasitol Res.2001;87(11):950­5.
keshavars A, Haghighi A, Athari A, Kazemi B, Nazemalhosseini Mojarad E. Genetic variation of Cryptosporidium spp. among children with Diarrhea in Iran. Iranian J Parasitol 2008;3(3):30­6.
.3 Sorvillo FJ, Liebl E, Kerndt PR, ash LR. Epidemiology of Cryptosporidiosis among person with acquired immunodeficiency syndrome in Los Angeles country. American J Trop Med Hyge 1994;51:331­63.
Xiao L, Ryan UM. Cryptosporidiosis: an update in molecular epidemiology. Curr Opin Infect 2004;17:483­90.
Tzipori S, Ward H. Cryptosporidiosis: biology, pathogenesis and disease. Microbes Infect 2002;4(10):1047­58.
Meamar AR, Guyot K, Certad G, Dei­Cas E, Mohraz M, Mohebali M, et al. SSU­rRNA gene analysis of Cryptosporidium spp. in HIV positive and negative patients. Iranian J Public Health 2006;35:1­7.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید