پژوهسالن ده چه (اردهمجلهم ، شما رپژوهشهآذري ۵ ،و داپدينش يگادر ه پعيل۱۳۸۸ وم۷۱ ، پزصفشكحي اتشهيد۲۴۷ تابهشت۲۵۳ ي) تاريختاريخ دپريافتذيرش مقامقاله له ::۹ /۲۶ /۲ ۸ /۱۳۸۷
۱۳۸۸/
بررسي عفونت همزمان انگل لشما نيا ماژور در اسلايدهاي پاتولوژيك بيماران مبتلا به گرانولوم ساركو ي يدي با استفاده از روش PCR
دكتر حميده مرو جفرشي۱ ، دكتر پروانه وصال۱ ، دكتر بهرام كاظمي۲ ، دكتر شيذر ناهيدي ۳ ، دكتر فريدون م ه بودي ۴
۱ . دانشيار ، مركز تحقيقات پوست ، دانشگاه علوم پزشكي شهيد بهشتي
۲ . استاد ، مركز تحقي قات بيولوژي سلولي ومولكولي ، دانشگاه علوم پزشكي شهيد بهشتي
۳ . پزشك عمومي ، مركز تحقيقات پوست، دانشگاه علوم پزشكي شهيد بهشتي
-9143227444

۴ . دانشيار ، مركز تحقيقات بيوتكنولوژي ، انستيتو پاستور ايران چ ك يده
سابقه و هدف : تاكنون عوامل بسياري در ارتباط با شروع و گسترش بيماري سار كوييدو ز مطرح شد هاند ، اما اخيراًا شواهدي مبني بر وجود رابطه اين بيماري با لشمانيا مطرح و گزارش شده است .
مواد و روش ها: اين مطالعه يك مطالعه مقطعي بوده كه به منظور جد اسازي گونه هاي شايع لشمانيا از بافت پوستي بيماران مبتلا به گرانولوم سار كو ييدي طراحي شده است . بدين منظور ،۲۵ بلوك پارا فينه از بيوپسي پوست بيماراني كه قبلاًلا تشخيص گرانولوم سار كو ييدي براي آنها گذاشته شده بود ، جمعآوري شده و مجددااً توسط يك پاتولوژيست با زخواني و بررسي شدند . با استفاده از روشهاي تشخيصي متعارف ورنگ آميزيهاي اختصاصي هيچ گونه عامل عفوني مشخصي در اين نمونه ها ياف ت نشد . سپس ب ه دنبال جد اسازي DNA و با استفاده از روش PCR نمونه ها از جهت وجود kDNA اختصاصي لشمانيا مورد بررسي قرار گرفتند . در اين بررسي تكثير يافتن قطعات bp۶۲۰ نشانگر وجود لشمانيا ماژور و وقطعات bp۸۳۰ حاكي از وجود لشمانيا تروپيكا بودند .
ياف ته ها: پس از ان جام آزمايش در۸ مورد (۳۲ %) از نمونه ها ، نتايج مطابق با باند رفرانس لشمانيا ماژور بود ، درحالي كه هيچكدام از نمونه ها مطابقتي با لشمانيا تروپيكا نداشتند . سن و جنس ارتباطي با وجود مثبت انگل در نمونه ها نداشت (۴ / ۰ p< )
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

نتيجه گي ري: به نظر مي رسد كه وجود انگل لشمانيا در مبتلايان به گرانولوم ساركوييدي شايع باشد . لذا توصيه ميشود كه در تمامي ضايعات باليني مشابه با س اركوييدو ز و ضايعاتي با هيستو پاتولوژي ساركوييدال گرانولوما ، تست PCR براي DNA اختصاصي لشمانيا روي نم ونههاي بيوپسي انجام گيرد .
واژگان كلي دي: لشمانيوز جلدي، لشمانيا L Major ، واكنش زنجيره اي پليمراز، گرانولوماي ساركوييدي، ساركوييدوز

مقدمه
۱ سار كوييدو ز يـك بيمـاري سيـستميك اسـت كـه بـا تـشكيل گرانولوم هاي اپ يتليو ييد غيـر ك ازئ يفيـه در بافـت هـاي مختلـف همراه بوده و مي تواند هريك از ارگان هاي بدن مانند ريه ، كبد ، غـدد لنفـاوي ، چـشم و پوسـت را درگيـر نمايـد ( ۱ ). هرچنـد تاكنون علت اصلي سـار كوييدو ز ناشـناخته مانـده اسـت ، ولـي گزارشـهاي متعـددي در رابطـه بـا نقـش احتمـالي يـا ابـتلاي همزمان با ميكروارگانيسم هاي متفاوت مثل مايكوباكترياها ( بـه خـصوص مايكوبـاكتريوم توبركولـوزيس ، مايكوبـاكتريوم هـاي آتيپيكـال ، مايكوبـاكتريوم لپـر ا) (۶ – ۲ ) ، ريكتزيـا هلوتيكـا ( ۷ ) ، لــشمانيا اينفــانتوم ( ۸ ) و بروســلا مليتنــسيس ( ۹ ) در بــروز سار كو ييدوز انتشار يافته است .
لشمانيوز پوستي كه ب ه وسيله گ ونههاي مختلف لشمانيا ايجـاد ميشود ، يك بيماري خود محدودشونده بوده كه بـ ه نـدرت بـ ه صورت يك بيماري پ يچيده تظاهر مي كنـد . هرچنـد لـشمانيوز يك عفونت گسترده در سطح دنياست ولي حـدود۹۰ % مـوارد ابتلا به آن در۷ كشور جهان از جمله ايران ب ه وقوع مي پيونـدد ( ۱۰ ). اين بيماري يك بيماري انـدميك در منـاطق حـاره اي و تحتحاره اي جهان است و در مناطق م ختلفي از ايران بـا بـروز بسيار بالا يافت ميشود (۱۲ – ۱۱ ).
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

۸۴۲
امروزه واكن ـــ ش زنج يـــــ ر هاي پلي ــــــ ـــمراز (Polymerase chain Reaction : PCR) به عنوان يك تست سريع ، حساس و اختصاصي براي رديابي بسياري از ميكروارگانيسم ها از جمله لشمانيا مورد استفاده وسيع قرار ميگيرد ( ۱۳ ). هدف اين مطالعه ، كشف احتمالي انگل لشمانيا به عنوان عامل اتيولوژيك ساركوييدوز و يا همراهي لشمانيوز و ساركوييدوز با استفاده از تكنيك PCR در مراجعين به مركز تحقيقات پوست دانشگاه علوم پزشكي شهيد بهشتي و بيمارستان شهداي تجريش، از دي ماه تا فروردين ماه۱۳۸۴ ، كه ب ه عنوان سار كوييدو ز پوستي تشخيص داده شد هاند ، بود . ب ه علاوه امكان كشف يك تابلوي باليني جديد ( و البته ن اشايع) از لشمانيا كه مي تواند تصوير باليني سار كوييدو ز را تقليد نمايد ، فراهم ميشود .
مواد و رو شها جمعآوري نمونه ها
تحقيق به روش توصيفي انجام گرفت . تعداد۲۵ بلوك پارافينه از بيوپسي هاي پوست بيماران مبتلا به گرانولوم سار كو ييدي كه براي آنها تشخيص باليني سار كوييدو ز پوستي گ ذ اشت ه شده بود ، گردآوري شدند . ابتدا اين نمونه ها با استفاده از روشهاي تشخيصي متداول شامل رنگ آميزي با هماتوكسيلين – ائوزين (H& E) ، گيمسا ، (Periodic Acid Schiff ( PAS ، زيل نيلسن از لحاظ وجود انگل لشمانيا ، قارچها وما يكوباكترياها مورد بررسي قرار گرفتند . سپس نمونه ها ب ه وسيله پاتولوژيست دوم مورد بازبيني قرار گرف تند كه تشخيص گرانولوم سار كو ييدي در تمامي نمونه ها ت اييد شد . گرانولوم سار كو ييدي ب ه صورت ذيل تعريف مي گرد د: جزا يري كاملاًلا مشخص از سلولهاي اپ يتليو ييدي كه محتوي معدودي سلولهاي ژئانت بوده و انفيلتراسيون پراكنده لم فوسيت ها در حاش يــــ ه اين گرانولوم هاي اپ يتليو ي يـــــ دي قرار د ارنــ د (گرانولوم ب ره ــنه يا Nacked granuloma) .
براي بررسي وجود لشمانيا در نمونه هاي فوق الذكر ا ز PCR استفاده شد . اين تست در مركزتحقيقات سلولي مولكولي دانشگاه علوم پزشكي شهيد بهشتي انجام گرديد و در مركز تحقيقات بيوتكنولوژي انستيتو پاستور ايران تكرار شد و نتايج ت اييد شدند .
ايزولاسيون DNA از بافت هاي پارافينه
استخراج DNA از بلوك هاي پارافينه بر اساس د ستور استفاده ك يتهاي شركت سيناژن انجام گرديد . بافت هاي پارافينه به وسيله ميكروتوم برش داده شد ند و قبل و بعد از برش هر نمونه ، تيغه ميكروتوم و ساير وسايل ب ه وسيله بنزن و اسيد كلريدريك شسته شده و با آب مقطر آبكشي و سپس ب ه وسيله اتوكلاو استريل مي شدند . براي حذف پارافين ، برش پارافينه يك شب در گزيلن قرار داده شد و سپس سانتريفيوژ شد و دو دفعه نيز با آ ب مقطر شستشو گرديد . نمونه به مدت۲ ساعــــ ت تا يك ش بــــ انه روز در باف ـــــــ ر ليز كن ن ده
(mM MgCl2 ، ۲۵ mM Tris ، ۱۰۰ mM sucrose۵ ، Triton­X100 ، % ۲ SDS۱ %) در حرارت۳۷ درجه انكوبه شد . واكنش مدت۱۰ دقيقه جوشانده شد و مدت۱۰ دقيقه با rpm۸۰۰۰ سانتريفيوژ شد ، مايع رويي كه حاوي DNA بود براي انجام واكنش PCR استفاده شد .
تست PCR با استفاده از كيت هاي اختصاصي تشخيص مولكولي شركت سيناژن (Leishmania sp. PCR
Determination and Detection, CinnaGen, Tehran, Iran) بر روي فرآورده هاي استخ راجشده DNA انجام شد . پرايمرهاي مورد استفاده ، اختصاصي كينتوپلاست لشمانيا ميباشند .
‘upstream 5’ TCGCAGAACGCCCCTACC 3 ‘3downstream 5’­AGGGGTTGGTGTAAAATAGGC واكنش PCR شامل۲ ميكروليتـر DNA (۱۰۰ نـانو گرم) ،۱۵۰ نـــ انومولار dNTP ،۴۰ پيكومـــول از هريـــك از پرايمرهـــاي Forward و Reverse ،۵ / ۱ ميلـ يمـولار 2MgCl ،۳ ميكـرو ليتـر
بافر PCR و۲۵ /۱ واحـد انـزيم Taq DNA polymerase بـود . واكنش در حجم۳۰ ميكروليتر انجام گرفت . پارامترهـاي PCR عبارت بودند از Denaturing در۹۴ درجه به مـدت۳۰ ثانيـه ، Annealing در دمــاي۶۲ درجــه بــه مــدت۳۰ ثانيــه و
Extension در دماي۷۲ درجه به مدت۳۰ ثانيه . اين مراحـل
۳۰ بار تكرار شدند . قبل ازاين مراحل ، واكنش مـدت۵ دقيقـه در دماي۹۴ درجـه و بعـد از اتمـام سـيكل هـاي PCR نيـز۵ دقيقه در دماي۷۲ درجه قرار داده شد ( ۱۴ ).
الكتروفورز محص ول:PCR
جهت ت اييد انجام PCR و اطمينان ازتكثير قطعه DNA هـدف ، محصول PCR روي ژل اگارز۱ % الكتروفـورز شـد ( ۱۵ ) و نـوار DNA مربوط به آن بعد از رنگ آميـزي بـا اتيـ ديومبرومايـد بـا
دستگاه UV Transilluminator مشاهده شد . اين متد تشخيصي يك روش پيـشرفته PCR اسـت كـه DNA ميتوك ندريال ( kDNA) انگل را ب ه عنوان هدف رديابي مي كند . با استفاده از اين كيت ميتوان گونه لشمانيا را بر اسـاس سـايز محصول PCR مشخص و تعيين نمود . به اين ترتيب كه قطعـ ه bp۶۲۰ نشانگر لشمانيا ماژور و قطع ه bp۸۳۰ حاكي از وجـود لشمانيا تروپيكا بودند.
۹۴۲
شكل۱ – بيمار ديابتيك با ضايعات پوستي ساركوييدوز باگرفتاري ريوي
A ۷ تا۶۵ سال بود . تمامي نمونه ها از ضايعات پوستي بيماران با تظاهرات باليني سار كوييدو ز انتخاب شده بودند . خصوصيات
شكل۲ – A : گرانولـوم سـاركو ييدي شـامل جزايـري از سـلولهاي اپيتليو ييد با تعداد معدودي سلول ژئا نت و مقادير بـسيار كمـي از سلولهاي ل مفوسيت در حاشيه اين جزاير( رن گآميزي هماتوكسيلين – ائوزين، بزرگنمـا يي اوليـه ×۴ ) B : يـك جـسم سـتار هاي شـكل
(asteroid body ) در يك سلول ژئانت چند ه ستهاي مشاهده مي شود
(بزرگنما يي اوليه ×۴۰ ) رتيكولومي گرانولوم ها را احاطه كرده بود . در رنگ آميزي هاي اختصاصي گيمسا، PAS و زيلنيلسن براي عفونت هاي لشمانيايي، قارچي و مايكوباكتريومي، هيچ گونه ميكروارگانيسمي يافت نگرديد . همچنين شواهدي دال بر وجود شكل آماستيگوت لشمانيا در رنگ آميزي H&E وجود نداشت .
تست PCR بر روي تمامي بافت هاي پارافينه انجام شد . در۸
8564881800

6949442162817

شيوع آلودگي انگل لشم انيا ماژور در نمونه هـا تعيـين و ميـزان واقعي آن در جامعه برآورد گرديد . نقش سن و جنس با وجـود انگل در نمونه ها مورد قضاوت آماري قرار گرفت .
ي افتهها
از۲۵ نمونه بلوك پارافينه مورد مطالعه ما ،۱۴ نمونه متعلق به مردان و۱۱ نمونه متعلق به زنان بود . ميانگين سني بيما راني كه مورد بيوپسي قرار گرفتند۵ /۳۷ و محدوده سني آنها بين
جنس و سن، محل ضايعه و برر سيهاي PCR نشان ميدهدكه نتيجه در۱۷ مورد (۶۸ %) منفي و در۸ مو رد (۳۲ %) مثبت بوده است . با توجه به اين شيوع در نمونه ها، ميزان واقعي آن با احتمال۹۵ درصد از حداقل۱۴ تا۵۰ درصد برآورد ميشود .
يكي از بيماران مبتلا به ديابت نوع۱ با درگيري پوستي و ريوي، تظاهرات سيستميك سار كوييدو ز را نشان مي داد ( شكل ۱ ) . تمامي اين افراد ت ست مانتو منفي داشته و در نماي B:
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

بافت شناسي ( در بررسي با ميكروسكوپ نور ي) داراي گرانولوم هاي سار كو ييدي بودند (شكل ۲ ). همچنين ساير تشخيص هاي افتراقي درآنها رد شده بود . نكروز ك ازِازئ وز در هيچ يك از ضايعات وجود نداشت ولي در يكي از نمونه ها نكروز في برينو ييد مشاهده ش د . در۵ نمونه، يك شبكه ظريف
609614279

نمونه باند تقويت يافته bp۶۲۰ كه حاكي از وجود DNA لشمانيا ماژور بود ، رؤيت شد كه در شكل۳ ، تعداد سه نمونه از نتايج ب هد ستآمده نمايش داده شد هاند . همچنين نتايج PCR انجام شده بر روي نمونه پوست و نيز لاواژ برونكيال بيمار مبتلا به درگيري سيستميك ، ب ه ترتيب در شكل هاي۴ و۵ مشاهده ميشوند .
بين سن و جنس بيماران با وجود انگل ارتباطي وجود نداشت
.( p< ۰ / ۴)
شكل۳ – نتايج به دست آمده از محصول PCR از سه نمونه پوست بيماران . ستون۱ : مـاركر وزنـي DNA ؛ سـتون۲ : كنتـرل منفـي؛ ستون۳ : كنترل مثبت و ستونهاي۴ تا۶ : محصول PCR نمونه هـايبيماران
1700784491052

۲۵۰
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:11 +0330 on Wednesday January 10th 2018

13197846777654

3

2

1

600
bp
500
bp

4

3

2

1



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید