سال پژوهنده (مجله چهاردهم، مردادشماره پژوهشيو 3 ، پي دردانشگاهشهريور پي علوم 138869، پزشكي صفحات شهيد147 تا 151بهشتي ) تاريخ تاريخ پذيرش دريافت مقاله:مقاله : 4/4/6/10/13881387

بررسي ژنوتيپ G1793A ژن MTHFR در بيماران مبتلا به سرطان كولوركتال اسپوراديك
دكتر مهدي منتظرحقيقي1*، روح ا… نجارصادقي2، دكتر سيدرضا محبي3، محسن واحدي4، دكتر محمدرضا زالي5

دكتري تخصصي ژنتيك، محقق، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
دانشجوي دكتري بيوشيمي، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
دكتري ويروس شناسي، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
دانشجوي دكتري آمار، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي
-9905205611

استاد، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي چكيده
سابقه و هدف: سرطان كولوركتال از شايعترين سرطان هاي كشنده در كشورهاي صنعتي ميان زنان و مردان است كـه دومـين عامـلمرگهاي حاصل از سرطان در آمريكا ميباشد. آنزيم 10 و 5 متـيلن تتراهيـدروفولات ردوكتـاز (MTHFR) كـه توسـط ژنMTHFR ساخته ميشود، در متيلاسيون، سنتز و ترميم DNA نقش دارد. علاوه بر آن اين آنزيم نقش مهمي در متابوليزم فولات بـر عهـده دارد.
در اين تحقيق پلي مورفيسم ژن 1793G>A) MTHFR) در افراد مبتلا به سرطان كولوركتال مورد بررسي قرار گرفته است.
مواد و روش ها: اين مطالعه يك مطالعه توصيفي است كه در آن، ژنوتيپ 227 بيمار مبتلا به سرطان كولوركتـال بـا اسـتفاده از روشPCR و Pyrosequencing مورد ارزيابي قرار گرفت.
يافته ها: فراواني ژنوتيپ هاي GA ،GG وAA در بين افراد مبتلا، به ترتيب 3/98%، 7/1% و صفر درصـد بـود. متوسـط سـن مبتلايـان3/68 سال بود ؛ ب ه طوري كه در افراد داراي ژنوتيپ GG ، 1/69 سال و در مبتلايان با ژنوتيپ GA، 8/66 سال تعيين گرديد. هيچ فـردمبتلايي با ژنوتيپ AA ديده نشد و 7/1% افراد مبتلا ژنوتيپ GA داشتند، در حالي كه افـراد مبـتلا بـه سـرطان كولوركتـال (3/98%)، داراي ژنوتيپ GG بودند
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:12 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:12 +0330 on Wednesday January 10th 2018

نتيجه گيري: به نظر مي رسد كه ژنوتيپ 1793G>A ژن MTHFR در بروز سرطان كولوركتال نقش داشته باشـد . تحقيقـات بيـشتر دراين زمينه توصيه مي شود.
واژگان كليدي: سرطان غيرفاميلي كولوركتال، آنزيم متيلن تتراهيدروفولات ردوكتاز، پلي مورفيسم، rs2274976 ،Pyrosequencing
15257258

مقدمه1
سرطان كولوركتال سومين سرطان شـايع در دنيـا مـي باشـد ودومين سرطاني است كه منجر به بيشترين ميزان مرگ و ميـرناشي از سرطان، در سراسر دنيا مي شود. سالانه 655000 نفـردر دنيا در اثر ابتلابه اين بيماري از بين مي روند و شيوع آن دريك قرن گذشته روند رو به رشدي را نشان داده اسـت (1و2).
بروز اين سرطان در ايـران نيـز در سـه دهـه گذشـته افـزايشداشته است و مشكلي جدي براي سلامت جامعه مـا بـه شـمارمـي آيـد (3). ايـن سـرطان داراي دو نـوع ارثـي (Familial) و

*نويسنده مسئول مكاتبات: دكتر مهدي منتظرحقيقي؛ تهران، اوين، بي مارسـتانطالق اني، مرك ز تحقيق ات بيماري ه اي گ وارش و كب د؛ پـست الكترونيـك:
[email protected]
غيــر ارثــي (Sporadic) مــي باشــد. 80% مــوارد بــ ه صــورت اسپوراديك هستند در حالي كه20% بقيه الگوي تـوارثي دارنـد(4).
همانند ساير سرطانها، فاكتورهاي محيطي و ژنتيكـي زيـاديدر ايجــاد ايــن بيمــاري دخيــل هــستند . احتمــالاً ســرطان كولوركتــال غيرفــاميلي بــا پلــي مورفيــسم هــاي موجــود درلوكوس هاي ژن ها در ارتبـاط اسـت. يكـي از شـايعترين انـواعپلي مورفيسمهايي كه امروزه در بيشتر مراكز تحقيقاتي جهـانبراي تعيين ارتباط آنها با سرطان هـا و بيمـاريهـاي گونـاگونمورد مطالعه قرار ميگيرند، چندشكلي هاي تـك نوكلئوتيـدي
.مي باشد SNPs يا (Single Nucleotide Polymorphisms)
آنزيم 5 و 10 متيلن تتراهيدروفولات ردوكتـاز كـه توسـط ژنmethylenetetrahydrofolate reductase) MTHFR 5,10-) كد مي شود، نقش مهمي در ايجاد ارتباط بين چرخه سـاخت ومتيلاسيون DNA دارد (9-5).
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:12 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:12 +0330 on Wednesday January 10th 2018

فعاليتMTHFR سبب تبديل 5 و10 متيلن تتراهيـدروفولاتبه 5 متيلن تتراهيدروفولات مي شود كـه مـاده اول بـه عنـوانسوبسترا براي سنتزDNA لازم است؛ در حالي كه دومين ماده در متيلاسيون DNA نقش دارد.
ژنMTHFR يك ژن پلي مورفيك ميباشد و پليمورفيسم هاي تك نوكلئوتيدي متنوعي در آن وجود دارد. يك پلي مورفيـسمشايع G1793A مي باشد كه تغيير نوكلئوتيد گوانين به آدنـينمنجر به جايگزيني اسيد آمينه آرژنين با گلوتـامين در كـدون594 ميشود. اين تغيير ، با كاهش فعاليت آنزيم همـراه اسـت
(10). هدف از انجام اين تحقيق ، بررسي ژنوتيپG1793A ، درافراد مبتلا به سرطان كولوركتال غيرارثي مي باشد.

مواد و روش ها
148/ دوماهنامه پژوهنده بررسي ژنوتيپ G1793A ژن MTHFR
اين تحقيق يك مطالعه توصيفي است كه بيماران به طور مستمر (sequentially) از افرادي كه در يك دوره زماني يكساله از 1/1/85 لغايت 1/6/86 به بخش كولونوسكوپي بيمارستان طالقاني تهران مراجعه كردهاند و نتيجه كولونوسكوپي آنها از نظر وجود بافت توموري با استفاده از آزمايش هاي پاتولوژي تاييد شده بود، انتخاب شدند. در نهايت تعداد 244 بيمار با اين شرايط به مطالعه وارد شدند. بيماراني كه سابقه فاميلي ابتلا به سرطان كولوركتال در بستگان درجه اول (پدر، مادر، برادر، خواهر و فرزند) و درجه دوم (پدربزرگ، مادربزرگ، عمه، خاله، عمو، دايي و نوه) داشتند، از مطالعه خارج شدند. از كليه بيماران رضايت نامه كتبي اخذ و در مورد نحوه استفاده از نتايج و داوطلبانه بودن حق شركت يا عدم شركت در اين مطالعه، توضيح داده شد. فرم رضايتنامه اخلاقي شركت افراد در مطالعه توسط كميته اخلاق مركز تحقيقات گوارش و كبد دانشگاه علوم پزشكي شهيد بهشتي تصويب شد و مورد استفاده قرار گرفت. از تمامي بيماران 10 ميلي ليتر خون محيطي جهت انجام آزمايش هاي ژنتيكي گرفته شد.
انتخابSNP : با بررسيSNP ها در ژنMTHFR با اسـتفادهاز بانك اطلاعاتي محتـــوي اطلاعات مربـوط بـه فــــ ركانس آللــــــي و هتروزايگــوتي SNP هــا ماننــد SNP500Cancer (http://snp500cancer.nci.nih.gov/) و ســـايت اختـــصاصيپـروژه بـين المللـي http://www.hapmap.org) Hap Map) و http://www.ncbi.nlm.nih.gov/SNP) dbSNP) ايــنSNP انتحاب شـد (11) كـه يـكSNP مهـم بـا شـماره دسترسـيrs2274976 در اگزون 11 اين ژن مي باشد كه در سـال 2002 براي اولين بار در دنيا تعيين شـد (12و13) و هتروزيگوسـيتيآن 126/0 مي باشد.
واكنش زنجيـرهاي پلـيمـراز (PCR): بـا اسـتفاده ازDNA استخراج شده از خـون محيطـي (بـا اسـتفاده از روش اسـتانداردفنل- كلروفرم ) (14)، ناحيه مورد نظـر از ژنMTHFR (شـمارهدستيابي ژنNC-000001 ) توسط يك جفت پرايمر كـه يكـي ازآنها (پرايمر فوروارد ) بيوتينه شده بود، تكثيـر يافـت. مشخـصاتمربوط به پرايمرها در جدول 1 آ مده است. شـرايطPCR بـراييك واكنش با حجم نهايي 25 ميكروليتر به اين شرح بـود: يـكميكروليتــر از DNA ژنــومي (100 نــانوگرم)، pM 20 از هــر پراي ـمر، mM 2/0 از هـر MgCl2 2mM ،dNTP و U/µl 2/0 از
Ampli taq Gold پليمراز. PCR با برنامه زير انجام گرفت:
دما زمان
94 درجه سانتيگراد 5 دقيقه
94 درجه سانتيگراد
59 درجه سانتيگراد
72 درجه سانتيگراد 42462371386

35
س
ي
كل

35

س

ي

كل

30 ثانيه
45 ثانيه
45 ثانيه
72 درجه سانتيگراد 10 دقيقه
جدول 1- توالي و مشخصات مربوط به پرايمرهاي PCR , Pyrosequencing
PCR, Pyrosequencing پرايمرهاي (5’→3′) Score: 98 Quality: High
توالي پرايمرId پرايمر bp Tm°C GC (%)
PCR Forward GTGGGCCTTGTTCTATTCCG 2070/6 55
1070539-198378

PCR Reverse ACGGGGACTCCTCCTCAT 18 68/4 61/1 Sequencing TTGCCCTGTGGATTG 15 54/6 53/3
Sequencing

شماره 3، پي در پي 69، مرداد و شهريور 1388 دكتر مهدي منتظرحقيقي و همكاران/ 149
Pyrosequencing
Pyrosequencing يك تكنيك توالي يابي DNA مي باشد كه بر اساس تشخيص پايروفـسفات (ppi) آزاد شـده در يـك واكـنشآبشاري آنزيمي و توليد نور مرئي در حين سـنتزDNA عمـل مي كند.
آبشار آنزيمي بـا پليمريزاسـيون يـك نوكلئوتيـد و آزاد شـدن پايروفسفات (ppi) به عنوان نتيجه استفاده آنزيم پليمراز از آن نوكلئوتيد، انجام ميشود. با به كار گيري نوكلئوتيـد بـه وسـيلهپلي مراز، پايرو فـسفات ، رهـا شـده و متعاقبـاً ATP را بـهATP سولفوريلاز تبديل مي كند كه انرژي لازم براي تبديل لوسيفرازبه اكسيد لوسي فرين و توليد نور را فراهم مي كند و از آنجـاييكه نوع نوكلئوتيد اضافه شده مـشخص اسـت، سـكانسDNA تعيين مي گردد (16و15).
Pyrosequencing با استفاده از محصولPCR و يك پرايم ـــر
Sequencing انجام شد (جدول 1).
آناليزSNP مورد نظـر بـا اســتفاده از نـرمافــــ زار مخـصوص (SNP Software) صورت گرفت. به اين صورت كه پيـكهـايحاصله بر اساس الگوي پاچش (dispensation) ارزيابي شـدند ،
تعيين ژنوتايپ به وسيله نرم افزار PSQ96MA V2.1.1 صـورتگرفت و نتايج بـه صـورت گـراف بـر روي مـانيتور متـصل بـهنرم افزار آشكار شدند.
آناليز آماري
متغيرهاي كمي به صورت ميانگين±انحراف معيار و متغيرهاي كيفي به صورت درصد بيان شدند. تجزيه و تحليل متغيرهاي گروه بندي شده با آزمون مجذور كاي و متغيرهاي كمي با آزمون t صورت پذيرفت.

يافته ها
از 244 نمونه مورد بررسي، 17 بيمار بـه دليـل عـدم تكميـلپرونده اطلاعات آنهـا، از مطالعـه حـذف شـدند . از 227 بيمـارباقيمانـده، 125 نف ر (1/55%) م رد و 102 نف ر (9/44%) زن بودند. ميانگين سني بيماران 3/68 سال ثبت شد (جـدول 2). ميانگين سني افراد بيمار داراي ژنوتيپ GG 4/6±1/69 سال و ميانگين سني بـراي مبتلايـان داراي ژنوتيـپGA 1/6±8/66 سال مشخص گرديد.
فراواني آللي در بيماران به ترتيب 99%G = و1%= A مـشاهدهشد. فراواني ژنوتيپ ها در بيماران براي ژنوتيپ



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید