پژوهن ده (مجله پژوهشي دانشگاه علوم پزشکي شهي د بهشتي) تاريخ دريافت مقاله ۲۲/۳/۸۶ سال سيزده م, شماره ۱ , پي در پي۶۱ ، صفحات ۱۷ تا ۲۳ تاريخ پذيرش مقاله ٢٨/٦/٨٦ فروردين و ارديبهش ت ۱۳۸۷

فراواني باکتري هاي انتروپاتوژن ج داسازي ش ده ازکودکان مبتلا به اسهال حاد در بيمارستان هاي تهران در سال ۸۴ ‐۱۳۸۳
فرشته ج عفري۱ ٭، دکتر مح مد مهدي اصلاني۲، ليلا شکرزاده۳، دکتر سياو ش سلمانزاده اهرابي۴، آناهيتا دزفوليان۳، دکتر ح ميد محقق
۵ ۶ ۷ ۸ ۹ شل ماني ، ح سين دبيري ، مستانه نوچي ، مح مد امين پور ح سين قلي ، دکتر مح مد رضا زالي

چکي ده
سابقه و ه دف: اسهال حاد دومين عامل مرگ و مير در کودکان زير ۵ سال محسوب مي شود. شناخت عامل اسهال براي نظارت اپيدميولوژيک و در بعضي موارد درمان صحيح بيماران‐ با توجه به اين که بيماري از نقطه اي به نقطه ديگر بسته به شرايط جوي، جغرافيايي و وضعيت اقتصادي و اجتماعي منطقه متفاوت مي باشد‐ ضروري به نظر مي رسد. اين مطالعه با هدف تعيين شيوع باکتري هاي انتروپاتوژن در استان تهران و ارزيابي علايم باليني آن ها انجام شد.
مواد و روش ها: از فروردين ۱۳۸۳ تا شهريور ۱۳۸۴، هزارو هشتاد و هفت کودک زير ۵ سال با اسهال حاد مراجعه کننده به
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

۴ بيمارستان و ۱۳ مرکز درماني در استان تهران جهت تعيين ميکروارگانيسم هاي انتروپاتوژن موجود در مدفوع آن ها از جمله اشريشياکلي مولد اسهال، گونه هاي شيگلا، سالمونلا، کمپيلوباکتر و يرسينيا مورد بررسي قرار گرفتند.
يافته ها: گونه هاي شيگلا با بالاترين ميزان شيوع در ۱۴۸ نمونه وجود داشت و اشريشياکلي مولد توکسين شيگSTEC
(Shiga Toxin Escherichia coli ) از ۱۰۵ نمونه مدفوعي جداسازي شد. هم چنين EPEC ،EAEC، کمپيـلو باکتـر، سالمونلا وETEC به ترتيب در۹۲، ۷۰، ۶۰، ۴۲ و ۳۸ مورد مشاهده شدند. در اين مطالعه هيچ گونه يرسينيايي از نمونه هاي مدفوع جدا نشد. بيش تر کودکان در اين مطالعه (۴۶۴ مورد) کم تر از يک سال سن داشتند.
نتيجه گيري: اطلاعات در مورد ميزان شيوع شيگلا و STEC مي تواند در کنترل و مديريت صحيح بيماري اسهال در ميان نوزادان و کودکان در ايران مؤثر باشـد. در حـال حاضر با توجـه به فـراواني اين سـوش ها، استفاده از واکسن ها در کنترل اشريشياکلي مولد اسهال، به خصوص عفونت هاي STEC در کشورهاي پيشرفته و کشورهاي در حال توسعه ماننـد ايران مي تواند مورد توجه قرار گيرد.
واژگان کلي دي: باکتری انتروپاتوژن ، اسهال حاد ، کودکان زير ۵ سال

مق دمه
(۱). شـناخت عامـل اسـهال بـراي نظـارت اپيـ دميولوژيک و در بعضـي موارد درمـان صحيـح بيماران‐ با توجه به اين که در بين بيماري هاي عفوني، اسـهال حـاد دومـين عامـلمرگ و مير در کودکان زير ۵ سال دنيـا محـسوب مـي شـود

۱ ٭ . نويسنده مسؤول :کارشناس ميکروبيولوژی، مركز تحقيقات بيماريهاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي آدرس براي مکاتبه: تهران، اوين، خيابان
تابنـاك، بيمارستان آيت ا … طالقـاني، مركز تحقيـقات بيـماري هاي گوارش و كبد دانشـگاه علـوم پزشكي شهيـد بهشتي. تلفـن و نمـابـر : ٢٢٤٣٢٥١٨‐ ٠٢١.
. [email protected] :پست الکترونيک
۲ . دانشيار، گروه ميکروبيولوژی، انستيتو پاستور ايران ٣ . کارشناس ارشد ميکروبيولوژی
٤ . دکترای ميکروبيولوژی ٥ . پزشک عمومي
٦ . دانشجوی دکترای ميکروبيولوژی، دانشگاه علوم پزشكي شهيد بهشتي ٧ . دانشجوی کارشناسی ارشد ميکروبيولوژی، دانشگاه علوم پزشكي شهيد بهشتي
٨ . دانشجوي دکترای آمار ۹ . استاد، مركز تحقيقات بيماري هاي گوارش و كبد، دانشگاه علوم پزشكي شهيد بهشتي

بيماري از نقطه اي به نقطه ديگـر بـسته بـه شـرايط جـوي،جغرافيايي و وضعيت اقتـصادي و اجتمـاعي منطقـه متفـاوت مي باشد ‐ ضروري به نظر مي رسد (۲). مطالعات انج ام شدهدر کشور انگليس نشان داده که ۲۰% اشخاص هر سال مبـتلابه عفونت هاي روده اي مي شوند (۳)، بنابراين خسارت هاياقتصادي ناشي از هزينه هاي درمان بيماران نيز بايستي موردتوجه قرار گرفته شود.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

پيشرفت در تکنيک هاي آناليز مولکولي، توانايي مـا را درشناسايي انت روپاتوژن ها در نمونـه هـاي مـدفوع و شناسـاييعوامل جديد در ارتباط با بيماري هاي اسهال بالا برده اسـت(۴). هدف از اين مطالعه بررسي ميزان شـيوع بـاکتري هـايانتروپاتوژن در بررسي نمونه هاي مدفوع کودکان ايراني داراياسهال حاد در استان تهران، با کمک تکنيـک هـاي تـشخيصمولکولي و بيوشيميايي و ارزيابي علائم باليني آن ها مي باشد.
مواد و روش ها
بيش تر مدفوع آبکي يا شل در ۲۴ ساعت ) مراجعـه کننـده بـه
در اين مطالعه توصيفي از فروردين ۱۳۸۳ تا شهريور ۱۳۸۴، ۱۰۸۷ کودک زير ۵ سال مبتلا به اسهال حاد (دفع سـه بـار يـاو Salmonella–Shigella Agar با مشخصات زير
(Promadisa, manufacture by Hispanlab, S.A Madrid)‐ براي گونه هاي سالمونلا و شيگلا، توسط روش هاي استاندارد کشت داده شدند و به مدت ۲۴ ساعت در دماي°C ۳۷ انکوبه شدند. جهت کشت کمپيلوباکتر ژوژني و کلي از محيط Campy Blood Agar حاوي مکمل (Himedia M 9960 Imdia) استفاده و به مدت ۴۸ ساعت در دماي °C۴۲ تحت شرايط ميکروائروفيليک (CO2 ،%۵ O2 ،%۸۳ N2 ۱۰%) انکوبه شدند و Yersinia
(Merck KGaA Darmstadt, – Selective AgarGermany) نيز در دماي°C۲۲ براي گونه هاي يرسينيا مورد استفاده قرار گرفت. باکتري هاي جدا شده، توسط روش هاي استاندارد ميکروبيولوژيکي شناسايي گرديدند (۵).
همه نمونه ها بر روي محيط مکانکي آگار (Merck GaA- Germany) کشت داده شده و به مدت ۲۴ ساعت در دماي °C۳۷ انکوبه شدند. براي استخراج DNA ، يک لوپ پر از باکتري هاي گرم منفي رشد يافته، از اولين ناحيه پليت مک کانکي آگار به ml ۵/۰ آب مقطر استريل منتقل
۴ بيمارستان و ۱۳ مرکـز بهداشـتي درمـاني در اسـتان تهـران
(کرج، ورامين، تهران) مورد بررسي قرار گرفتند.
نتايج معاينات باليني، درمان و اطلاعات مربوط به سـن،جنس، علا ي م باليني (تب، استفراغ، درد شـک م، تهـوع)، انـواعاسهال (بلغمي، آبکـي، خـوني) و مراقبـت هـاي پزشـکي، درپرسشنامه مربوطه توسط پرسشگر ثبت شد.
نمونه هاي مدفوع گرفته شده از بيماران در محـيط هـايانتقالي کري بلر و بـافر سـالين فـسفات در جعبـه هـاي يـخ (ice-pack) در ک م تر از ۶ ساعت به آزمايشگاه بيماري هايناشي از غذا واقع در مرکز تحقيقات بيمـاري هـاي گـوارش وکبد دانشگاه علوم پزشکي شهيد بهشتي انتقال يافت.
نمونه هاي مدفوع از بيماران داراي اسهال حاد بر روي
(XLD) Xylose–Lysine–Desoxycholate–agar شده و به مدت ۲۰ دقيقه جوشانده شد. PCR از DNA استخراج شده از کشت اوليه ناحيه اي ناخالص، توسط ۶ جفت پرايمر st, lt ،stx2, stx1, eae و پلاسميد pCVD432 انجام شد (جدول ۱).
تست اسلايد اگلوتيناسيون براي شناسايي ژن+ stx بوسيله آنتي سرم هاي(Mast company) O157:H7 انجام شد. PCR در مخلوطي با حج م µl۲۵ حاوي µl۲ از سوسپانسيون حاوي DNA, ۵/۱ ميلي مولار کلريد منيزي م، ۲/۰ ميلي مولار دزوکسي ريبو نوکلئوتيد (از هرکدام) ، ۵/۲ واحد آنزي م Tag پلي مراز و ۴/۰ ميکرومول پرايمر انجام شد.
سپـس همـه ي نمـونه هـا در يک دستـگاه ترمو سايکـلر (Eppendorf AG , 2233, Hamburg, Germany) که سيکل هاي آن ها شامل واسرشت شدن DNA به مدت ۲ دقيـقه در دماي °C۹۵ ، سپـس ۳۰ سيـکل به مـدت ۳۰ ثانيه در °C۹۴، ۳۰ ثانيه در دماي °C۶۰ و ۳۰ ثانيه در دماي °C۷۲ بود تکثير يافتند. کنترل هاي مثبت مورد
و (LT+, ST+) E.coli ATCC 35401 :استفاده شامل
۱ ساعت با ولتاژ ۱۰۰ الکتروفورز گرديده و سپس توسط
جدول ش ماره ۱: توالي و ژن هاي مورد استفاده براي شناسايي سويه هاي اشرشياکلي مولد اسهال
ژن ه دف توالي پرايمر(‘3-‘5) ان دازه ژن (bp) رفرانس پرايمر
STEC (stx1) CAGTTAATGTGGTGGCGAAG CTGCTAATAGTTCTGCGCATC ۸۹۴ ٢٥
STEC (stx2) CTTCGGTATCCTATTCCCGG GGATGCATCTCTGGTCATTG ٤٧٨ ٢٥
EPEC (eae) TGCGGCACAACAGGCGGCGA
CGGTCGCCGCACCAGGATTC ٦٢٩ ٢٦
EAEC
(pCVD432) CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT ٦٣٠ ٧
ETEC (lt) TCTCTATATGCACACGGAGC
CCATACTGATTGCCGCAAT ٣٢١ ٢٥
ETEC (st) TCTGTATTGTCTTTTTCACC TTAATAGCACCCGGTACAAGC ١٨٦ ٦
.بود (stx1+, stx2+, eae +) E. Coli ATCC 43894 (Agarose %۱/۵ بر روي ژل آگارز PCR محصولات به مدت LE Roche applied science, Germany)

اتيديوم برمايد رنگ آميزي و بعد در زير نور UV مشاهده شدند. مارکر kb ۱ فرمنتاز براي تخمين اندازه قطعات محصول PCR مورد استفاده قرار گرفت. تست اسلايد اگلوتيناسيون جهت شناسايي اشريشياکلي O157:H7 براي کلني هايي که ژن stx مثبت شدند، بوسيله آنتي سرم هاي
.انجام شد O157:H7 (Mast Company)
يافته ها
علاي م باليني و فراواني نمونه ها بر اسـاس فـصول مختلـفسال در جـدول ۲ نـشان داده شـده اسـت. از ۱۰۸۷ کـودکداراي اسهال حاد، نسبت پـسران بـه دختـران ۱: ۲/۱ بـود و۷/۴۲% (۴۶۴ نفر) از نمونه ها مربوط به کودکان ک م تـر از ۱ ســال بودنــد. از ۵۱% نمونــه هــاي اســهالي (تعــداد ۵۵۵)، باکتري هاي بيمـاريزا جـدا شـد و در سـاير بيمـاران (تعـداد۵۳۲) هيچ گونه باکتري بيماري زايي يافت نشد. در بـيش از
۷/۱۹% بيماران درد شـک م مـشاهده گرديـد و بـه دنبـال آن
۶/۲۹% اسهال ها همراه با تب بود (جدول۲).
پاتوژن ه ـاي روده اي مختلف و فراواني آن ها در جدول ۳ نـشان داده شـده اسـت. از نمونـه هـاي مـدفوع، ۵۲۵ مـورد (۳/۴۸%) کودک مراجعـه کننـده بـا اسـهال حـاد، يـک نـوعباکتري بيماري زا جدا شد و در ۳۰ مورد (۸/۲%) چندين نوعباکتري بيماري زا شناسـايي و در ۴۹% از آن هـا هـيچ گونـه
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

باکتري بيماري زايـي جـدا نـشد (جـدول ۳و۴). شـايع تـرين آن ها گونه هاي شيگلا (۷/۲۶%) و سپسEPEC ,EAEC وSTEC به ترتيب با فراواني ۱۰۵، ۹۲ و ۷۰ بودند (جـدولشماره ۳). از ۳۸ سويهETEC جدا شده، توکـسينLT در۱۳ مورد (۳/۲%) و توکسينST در ۱۷ مورد (۱/۳%) از کـلنمونه هاي باکتريايي شناسايي شد. ۸ مورد (۴/۱%) نيز حاوي هر دو توکسين بودند. در ميان جدايـه هـايSTEC ، در ۱۰ سويه +eae-, stx2+, stx1 شناسـايي شـدند کـه۶ جدايـهوجود داشت که هر سـه ژن، stx2, stx1,eae را داشتنـد.

1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

هيچ کداماز سويه هاي stx1, stx2 جزو E.coli O157-H7 نبودند. فراواني عفونت هاي چنـد عـاملي در جـدول شـماره ۴ ن شان داده ش ـده اســت. ۸۴ م ورد (۷/۷%) قب ل از معاينــه در بيمارستان يا مراکز درماني، آنتي بيوتيک دريافت کرده بودندکه از بين آن ها فقط در ۱۵ مـورد (۸۵/۱۷%) بـاکتري هـايانتروپاتوژن جدا شد.
جدول ۲ ‐ م شخصات کلي بي ماران مبتلا به اسهال (۱۰۸۷= n)
تعداد (درص د) علائ م باليني و ديگر
مشخصات نمونه ها

(١٩) ٢٠٧ فص ل
بهار
(٤٨/٥) ٥٢٨ تابستان
(٢٠/١) ٢١٩ پاييز
(١٢/٤) ١٣٥ زمستان

(٧/٧) ٨٤
(١٧/٣) ١٦٦ سن (ماه)
٠‐٢
٣‐٥
(١٩/٧) ٢١٤ ٦‐١١
(٢٣/٨) ٢٥٩ ١٢‐٢٣
(١٠/٧) ١١٦ ٢٤‐٣٥
(٢٢/٩) ٢٤٩ ٣٦ ‐٦٠
۱:۱/۲ جنس (دختر/ پسر)
٦/٨٩± ۳۳/۰۷ ميانگين سن پسر ( SD± )
٧/٢٧± ٣٢/٩٣ ميانگين سن دختر SD )± )

٢/٧±٧/١ اسهال
تعداد دفعات دفع
(٤٢) ٤٥٧ آبکي
(١٩/٩) ٢١٧ بلغمي
(٩/٦) ١٠٤ خوني
(٢٨/٥) ٣١١ نامشخص
(٥٤/٩) ٥٩٨ استفراغ
(٢٨/٨) ٣١٤ بي اشتهايي
(٢٩/٦) ٣٢٢ ت ب
(١٩/٧) ٢١٥ درد شک م
(٧/٧) ٨٤ مصرف آنتي بيوتيک
جدول ۳ : شيوع باکتري هاي مختلف پاتوژن شناسايي شده در کودکان داراي اسهال حاد باکتريايي (٥٥٥=n)
تع داد بيماران (%) a انتروپاتوژن
(%۲۶/۷) ۱۴۸
شيگلا
STEC
(%۵/۴) ۳۰
(%۱۱/۷) ۶۵
(%۱/۸) ۱۰ stx1 stx2 stx1/stx2
(%۱۶/۶) ٩٢ EAEC
(%۱۲/۶) ٧٠ EPEC
(%۱۰/۸) ٦٠ کمپيلو باکتر
(%۷/۶)
۴۲ سالمونلا
ETEC
(%۲/۳)
(%۳/۱)
(%۱/۴) ١٣
١٧
٨ LT
ST
LT/ST
۰ يرسينيا
درصد کودکاني که عامل بيماري زا از آ ن ها جدا سازي شده است a (%)
جدول ٤ ‐ تعداد و درصد فراوانی انواع اسهال هاي ه مراه با بي ش از يک باکتري
نوع باکتري تع داد (%)
Shigella flexneri/EAEC ٦ (۱/۰۸)
Salmonella paratyphi A/ETEC ٢ (۰/۳۶)
Shigella boydii/EAEC ٢ (٠/٣٦)
Salmonella typhi/EPEC ١ (٠/١٨)
Salmonella paratyphi C/EPEC ٦ (۱/۰۸)
Shigella sonnei/EAEC ٢ (٠/٣٦)
Salmonella group D/EAEC ١ (٠/١٨)
Shigella flexneri/STEC ۳ (۰/۵۴)
Campylobacter/STEC ٣ (۰/۵۴)
Campylobacter/EAEC ٤ (۰/۷۲)
تع داد ٣٠ (۵/۴)
جدول ش ماره ٥ : علاي م باليني بي ماران داراي اسهال حاد با يک عام ل باکتريايي
ت ب(%) استفراغ(%) اسهال آبکي
(%) اسهال بلغمي
(%) اسهال خوني
(%) ميانگين سن (ماه) تع داد سويه هاي ج دا شده باکتري
٤٠/٥ ٥٥/٤ ٣٧/٢ ١٤/٩ ٢٠/٣ ١٩ ± ٣٠/٢٨ ١٤٨ شيگلا
٥٣/٣ ٤٥/٧ ٥٠/٥ ٢٣/٨ ١٦/٢ ١٧/١ ± ٢٠/٣٤ ١٠٥ STEC
١٧/٤ ٥٧/٦ ٢٣/٩ ١٣/٠ ٥/٤ ١٦/٩ ± ١٧/٤٥ ٩٢ EAEC
٢٠ ٥٧/١ ٣١/٤ ١١/٤ ٧/١ ١٧/٨ ± ١٩/٩٥ ٧٠ EPEC
٢٦/٧ ٥٣/٣ ٥٥ ٣٦/٧ ١٣/٣ ١٦ ± ١٨/١٢ ٦٠ کمپيلو باکتر
٢٢/٩ ٦٦/٧ ٢٠/٨ ٤/٢ ٢/١٦ ١٦/٢ ± ١٧/٥ ٤٢ سالمونلا
٢٨/٩ ۵۰ ٢٨/٩ ١٨/٤ ٧/٩ ٢٠ ± ٢٦/٥ ٣٨ ETEC

مطالعــه حاضــر نــشان داد کــه در۶۰ مــورد (۸/۱۰%) کمپيلوباکتر ژژونـي و۴۲ مـورد (۶/۷%)گونـه هـاي سـالمونلاجداسازي شـده اسـت. در ايـران گونـه هـاي کمپيلوبـاکتر و گونه هاي سالمونلا در مقايسه با عوامـل ديگـر ايجـاد کننـدهاسهال و ه م چنين در مقايسه با کشورهاي توسعه يافتـه کـهاين دو ارگانيس م به عنوان شـايع تـرين عامـل باکتريـايي دراسهال حاد قلمداد مي شوند، از اهميـت کـ م تـري برخـوردارهستند (۱۳و۱۴). شيوع کمپيلوباکتر ژژوني، اشريشيا کلـي و بح ث
اسهال يکي از مشکلات اساسي براي سـلامت کودکـان در
ايران و ساير کشورهاي در حال توسـعه مـي باشـد (۹و۱۰) و شناخت باکتري هاي انتروپاتوژنيک عامـل بيمـاري اسـهالي،براي کنترل اين بيماري ضروري مي باشد . اين مطالعه که بـهمدت ۲ سال در ۵ بيمارستان در اسـتان تهـران انجـام شـد،تعيين کننده ميزان شيوع اسهال حاد ناشي از بـاکتري هـايانتروپاتوژنيک در کودکان زير ۵ سال مي باشـد. بـا اسـتفاده
تــوأم تکنيــک هــاي تشخيــصي متــداول و مولکــولي، مــا يرسينيا انتروکوليتيکا مشابه با گزارش هـاي قبلـي در ايـران
مي باشد (۱۵).
اشريشياکلي مولد اسهال از شايع ترين عوامل اسهال حـاددر ايران به ويـژه در کودکـان، بـيش تـر توسـط روش هـايتشخيصي مانن د ک شت و س رولوژي ن سبت ب ه مولک وليشناسايي شده است (۹و۱۰و ۱۶).
در بررســـي حاضـــر EPEC در ۷۰ مـــورد (۶/۱۲%) باکتري هاي انتروپاتوژن را در ۵۵۵ مـورد (۵۱%) از بيمـاراناســهالي شناســايي کــردي م . شــيگلا يکــي از بــاکتري هــاي بيماري زاي مهـ م در کـشورهاي در حـال توسـعه و يکـي از مه م ترين عوامل اتيولوژيکي اسهال حاد در ايران به ويـژه درکودکان مي باشد (۱۰و۱۱). در اين مطالعه گونه هاي شـيگلااز ۱۴۸ مورد بيمار (۷/۲۶%) جـدا شـده، کـه در مقايـسه بـا
ســاير مطالعــات انجــام شــده در ايــران (۸/۱۶%) افــزايش را شناسايي شده است که در مرتبه سوم اهميـت باکتريـايي در
ايجاد اسهال حاد قرار دارد، در حالي کـه در مطالعـات قبلـي
اين ارگانيس م بيش ترين فراواني را به خود اختصاص داده بود(۱۰و۱۶). با توجه به نتـايج به دسـت آمـده در ايـن مطالعـه نشان مي دهد . اين يافته ها نشان گر فراواني بالاي شيگلا در
ايران در مقايسه با کشورهاي پيشرفته و بعضي کشورهاي درحال توسعه مي باشد (۱۲‐۱۰).
در ارزيابي علائ م باليني مرتبط به عفونت و شيوع باکترياييانتروپاتوژن (جدول ۵)، گونه هاي کمپيلوباکتر، فراوان تـرينعامل همراه با مدفوع آبکي (۵۵%) و اسهال بلغمـي (۷/۳۶%)

1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

بودند. شيگلا نيز بالاترين درصد را در اسهال خوني بـه خـوداختصاص داده بود.

شيگلا و سپسSTEC مي تواند به عنوان سويه هاي غالب ايجاد کننده اسهال حاد در کودکـان زيـر ۵ سـال در منطقـهمطرح باشد . سـويه هـايEAEC وETEC بـه ترتيـب در۶/۱۶% و ۸/۶% مـوارد جـدا شـد کـه در مقايـسه بـا مطالعـه قبلي(۱۶%) سويه هايETEC کاهش چش م گيري داشـته، در حــالي کــه تفــاوت چنــداني در فراوانــيEAEC (۱۶%) مشاهده نشد (۱۸).
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

بررسي ها نشان داد کـه غالـب تـرين اشريـشياکلي مولـداســــهال (STEC (Diarrhegenic E.coli (۹/۱۸%) مي باشد که در مقايسه با نتايج به دست آمـده در مطالعـاتانجام شده در استان تهران در جمعيت نرمال و غيـر اسـهالي
عدموجود اطلاعات در مورد فراواني ايـن بيمـاري، بررسـي وپ ـژوهش در زمين ه ســندرم هموليتي ک اورميــک (HUS) ضروري به نظر مي رسد (۲۱).
علــي رغــ م نقــش مهــ م Diarrhegenic E.coli در اسهال حاد ايران، اين ارگانيس م در آزمايشگاه هاي تـشخيص
طبي ايران، مورد توجه قرار گرفته نمـي شـودو سـويه هـاي جدا شده، بهعنـوان فلـور نرمـال بـهويـژه در بـالغين تلقـي مي شود . مطالعه ما فراواني قابـل توجـه ايـن ارگانيـس م را درميان عوامل باکتريايي مولد اسهال تأييد مي کند.
معرفي تکنولوژيPCR به آزمايشگاه ها، بطور قابل توجهيشناسايي اشريشياکلي مولد اسهال را آسان کرده است.
فراوانـي بـالايي (۹/۴% ، ۷/۰%) را نـشان مـي دهـ د (۹و۱۹). بنابراين اطلاعات در مـورد ميزان شيـوع انتروپاتـوژن ها،
منابع و روش هاي انتقال و فاکتورهاي خطرساز عفونت هاي ناشي از آن ها، کنترل و مديريت بيـماري هاي اسهالي را در ميان نوزادان و کودکان تسهيل مي کند و با توجه به فراواني سوش هاي اشريشياکلي مولد اسهال، انجام مطالعات وسيع تر و استفاده از واکسن جهت کنترل اين سويه ها به خصوص عفونت هاي ناشي ازEPEC و STEC در ايران مي تواند مورد توجه قرار گيرد. ه م چنين يافته هاي ما نشان مي دهد که فراواني سويه هايSTEC در ايران در مقايسه با کشورهاي توسعه يافته تفاوت قابل تـوجهي دارد (۲۰). از آن جـايي کـه توکـسين بـاکتري STEC مــي توانــد در بيمــاري زايــي ســندرم هموليتيــکاورميک (HUS) نقش داشته باشد و اين سندرم عامـل يـکبيماري کشنده و نقص کليه مي باشد، انتظار مي رود فراوانيHUS در جامعه مورد مطالعه بالا باشـد. بنـابراين بـه دليـل
REFERENCES

.1 Bern C, Martinez J, de Zoysa I, Glass RI. The magnitude of the global problem of diarrhoeal disease: a ten-year update. Bull World Health Organ. 1992; 70(6):705-14.
.2 Yamashiro T, Nakasone N, Higa N, Iwanaga M, Insisiengmay S, Phounane T et al. Etiological study of diarrhoeal patients in Vientiane, Lao People’s Democratic Republic. J Clin Microbiol 1998; 36:2195-9.
.3 Wheeler JG, Sethi D, Cowden JM. Study of infectious intestinal disease in England: rates in the community, presenting to general practice, and reported to national surveillance. BMJ 1999; 318:1046-50.
.4 Svenungsson B, Lagergren A, Ekwall E, Evengard B, Hedlund KO, Karnell A et al. Enteropathogens in adult patients with diarrhea and healthy control subjects: a 1-year prospective study in a Swedish clinic for infectious diseases. Clin Infect Dis 2000; 30(5):770-8.
.5 Kelly MT, Brenner DJ, Farmer J. Enterobacteriaceae. In: Clennette EH, Ballows A, Tausler Jr WJ and Shadomy HJ. Manual of clinical microbiology. 4th ed. Washington, DC: ASM press.1985; P: 263-277.

.6 Olsvik O, Strockbine NA. PCR detection of heat-stable, heat-labile, and shiga-like toxin genes in Escherichia coli. In: Persing DH, Smith TH, Tenover F, White TJ, editors. Diagnostic molecular microbiology-Principles and applications. Washington DC: ASM. 1993; P: 271-6.
.7 Heuvelink AE, Van de Kar NC, Meis JF, Monnens LA, Melchers WJ. Characterization of verocytotoxin- producing Escherichia coli O157 isolates from patients with haemolytic uremic syndrome in Western Europe. Epidemiol Infect 1995; 115:1-14.
.8 Schmidt H, Knop C, Franke S, Aleksic S, Heeseman J, Karch H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol 1999; 33: 701-5.
.9 Salmanzadeh-ahrabi S, Habibi E, Jafari F, Zali MR. Molecular epidemiology of Escherichia coli diarrhea in children in Tehran. Ann Trop Ped Liverpool, UK. 2005; 25: 35-9.
.01 Katouli M, Jaafari A, Farhoudi-Moghaddam AA, Ketabi GR. Etiological studies of diarrhoeal diseases in infants and young children in Iran. J Trop Med Hyg 1990; 93: 22-7.
.11 MoezArdalan K, Zali MR, Dallal MM, Hemami MR, Salmanzadeh-Ahrabi S. Prevalence and pattern of antimicrobial resistance of Shigella species among patients with acute diarrhoea in Karaj, Tehran, Iran. J Health Popul Nutr 2003; 21(2): 96-102.
.21 Jamal WY, Rotimi VO, Chugh TD, Pal T. Prevalence and susceptibility of Shigella species to 11 antibiotics in a Kuwait teaching hospital. J Chemother 1998; 10(4): 285-90.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

.31 Bellido JB, Galiano JV, Tirado MD, Gonzalez-Cano JM, Safont L. Incidence of sporadic cases of the most frequent intestinal infections in Castellon. Rev Esp Salud Publica 2003; 77(5): 629-38.
.41 Katouli M, Ketabi GR, Ketabi GR. The role of diarrhoeagenic Escherichia coli in acute diarrhoeal diseases in Bandar-Abbas, Iran. J Med Microbiol 1988; 27(1):71-4.
.51 Soltan-Dallal M.M, Moezardalan K. Frequency of Yersinia species infection in paediatric acute diarrhea in Tehran. Eastern Mediterranean Health Journal. 2004; 10(1,2):152-8.
.61 Aslani MM, Badami N, Mahmmoodi M, Bouzari S. Verotoxin-producing Escherichia coli (VTEC) infection in randomly selected population of Ilam Province (Iran). Scand J Infect Dis 1998; 30 (5) :473-6.
.71 Seung-Hak Cho, Jong-Hyun Kim, Jong-Chul Kim, Hyun-Ho Shin, Yeon-Ho Kang, Bok-Kwon Lee. Surveillance of Bacterial Pathogens Associated with Acute Diarrheal Disease in the Republic of Korea During One Year, 2003. J Microbiol Soc Korea 2006; 44(3): 327-35.
.81 Rezayi M, Salmanzadeh-ahrabi S, Edalatkhah H, Jafari F, MoezArdalan S, Zolfagarian K, et al. Epidemiology of bacterial-induced acute diarrhea in Varamin. Pejouhandeh Bimonthly Research Journal 2004; 8(7): 467-474.
.91 Aslani MM, Bouzari S. An epidemiological study on Verotoxin-producing Escherichia coli (VTEC) infection among population of northern region of Iran (Mazandaran and Golestan provinces). Eur J Epidemiol 2003; 18(4): 345-9.
.02 Keskimaki M, Eklund M, Pesonen H, Heiskanen T, Siitonen A; Study Group. EPEC, EAEC and STEC in stool specimens: prevalence and molecular epidemiology of isolates. Diagn Microbiol Infect Dis 2001; 40(4): 151-6.
.12 Black RE, Morris SS, Bryce J. Where and why are 10 million children dying every year. Lancet 2003; 361: 2226-34.



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید