پژوهن ده (مجله پژوهشي دانشگاه علوم پزشکي شهي د بهشتي) تاريخ دريافت مقاله ۱۵/۷/۸۵
سال دوازده م, شماره ۶ , پي در پي ۶۰ ، صفحات ۵۱۳ تا ۵۱۹ تاريخ تجديد نظر ۱۹/۴/۸۶
تاريخ پذيرش مقاله ٢١/٥/٨٦ بهمن و اسفن د ۱۳۸۶

بررسي مولکولي ژن تولي د کنن ده پروتئين فاز گرمايي ۶۰ کيلو دالتوني در قارچ بيماري زاي ميکروسپوروم کنيس
دکتر کاميار متواض ع۱ ، آريو جهانگيرنژاد۲ * ، دکتر م س عود امامي۳ ، ديـويـد يـاشـارال۴ ، دکتر ساسان رضائي ۵

چکي ده
سابقه و ه دف: پروتئين هاي شوك گرمائي (Heat Shock Proteins يا به اختـصارHSPs) بـه عنـوانChaperone هـايمولكولي عمل كرده و از طريق تنظيم تا خوردگي و انتقال درون سلولي پروتئين هاي تازه سنتز شده، سلول را در مقابل صدماتناشي از استرس هاي محيطي، محافظت مي كنند. اين مطالعه بـا هـدف مـشخص کـردن ژنHSP60 در درماتوفيـت پـاتوژنميکروسپوروم کانيس انجام شد
1268731734566

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

مواد و روش ها: نمونه قارچ ميکروسپوروم کانيس از بيماران مبتلا به درماتوفيتوزيس جمع آوري گرديده و در شرايط مناسب کشت داده شد. DNA با وزن ملکولي سنگين که از توده ميسليومي به دست آمد، با روش هاي استاندارد جدا شد. جفت پرايمرهايي با ۲۱ نوکلئوتيد از نواحي حفاظت شـده (highly conserved ) از ژن هاي HSP60 ساير سلـول هاي يوکاريـوت، طراحي شد. پرايمرهاي ذکر شده به وسيله ي DNA ژنومي (template ) جدا شده از ميکروسپوروم کانيس در PCR مورد استفاده قرار گرفت. مولکول هاي پيش بيني شده، تقويت شدند و براي تعيين سکانس فرستاده شدند.
يافته ها: توالي نوکلئوتيدي ژن HSP60 به دست آمده شامل ۱۵۵۰ نوکلئوتيد است که پروتئيني با ۴۹۷ آمينواسيد را رمز مي نمايد.
نتيجه گيري: در مطالعه حاضر، ما هويت و خصوصيت مولکولي يک ژن از ميکروسپوروم کنيس که کدکننده يک پروتئين متعلق به خانواده ي پروتئين شوک حـرارتي ۶۰ کيـلو دالتـوني ملقب به McHSP60 مي باشـد را بررسـي کرده ايم. آناليـز سکانس آمينواسيدي اين ژن شباهت قابل توجهي با HSP60 ساير يوکاريوت ها نشان مي دهد، چنان که بيش از ۹۷% با C.immitis ،
۹۲% با Aspergillus fumigatus و ۷۴% با S.cerevisiae همولوژي دارد. تجزيه و تحليل ترکيب آمينواسيدي در HSP60 بيانگر غني بودن آن از آلانين، گلوتاميک اسيد و گلايسين است. ترکيب آمينواسيدي McHSP60 نشان دهنده ناچيز بودن
مقدار سيستئين و تريپتوفان در آن مي باشد
واژگان کلي دي: درماتوفيت ، ميکروسپوروم کانيس ، PCR ، کاپرون ، HSP

مق دمه
استرس هاي محيطي از قبيل اشعه ماوراء بنفش (۱) و يا شوک هاي حرارتي و املاح فلزات سنگين (۲)، در اغلب موجودات زنده، اعم از يوکاريوتي و پروکاريوتي، ژن هاي شوک
بايد بتوانند به گونه اي اين تنش ها را تحمل کنند. گرمائي را فعال مي کند که باعث توليد HSP مي شود (۳ و۴).

۱ ٭ . نويسنده مسؤول : استاديار ، گروه ميکروبيولوژي ، دانشکده علوم پايه ، دانشگاه آزاد اسلامي واحد تهران شمال . آدرس براي مکاتبه: تهران، ميدان قد س، خيابان دربند، دانشگاه آزاد اسلامي واحد تهران شمال، دانشکده علوم پايه. تلفن: ۰۹۱۲۱۷۲۱۰۱۴ . پست الکترونيک: [email protected]
۲ . کارشناس ارشد ميکروبيولوژي ، دانشکده علوم پايه ، دانشگاه آزاد اسلامي واحد تهران شمال
. استاد گروه ميکروبيولوژي ، دانشکده علوم پايه ، دانشگاه آزاد اسلامي واحد تهران شمال
. کارشناس ارشد ميکروبيولوژي ، دانشکده علوم پايه ، دانشگاه آزاد اسلامي واحد تهران شمال
. استاديار، گروه قارچ شناسي و انگل شناسي ، دانشکده بهداشت ، دانشگاه علوم پزشکي تهران
موجودات زنده، چه پر سلولي و چه تک سلولي به طور مستقيم يا غير مستقيم در ارتباط با عوامل محيطي مي باشند و هنگامي که تحت تأثير استرس هاي محيطي قرار مي گيرند
بالا از قارچ درماتوفيت ميکروسپوروم کانيس جدا شد. براي اين منظور، توده ميسليومي فريز شده از اين قارچ در داخل هاون چيني و با استفاده از نيتروژن مايع خرد شد تا به شکل يک پودر يکنواخت در آمد. محلول استخراج DNA شامل Tris-HCl ۵۰ ميلي مولار (۸ : EDTA ،(PH ۵۰ ميلي مولار، β ، %۳ SDS – مرکاپتواتانول ۱% و پروتئيناز K (mg/ml ۲۰) مي باشد. سوسپانسيون حاصل در حرارت oC ۶۵ براي مدت يک ساعت انکوبه شد و بعد از سانتريفيوژ با دور g ×۲۵۰۰ براي مدت ۱۵ دقيقه، رسوبات سلولي حذف شد. بعد از افزودن ۲۵ ميکروليتر از محلول RNase-H (mg/ml ۱۰) جهت از بين بردن RNA موجود، سوسپانسيون
۵۱۴
واکنـش هاي متـقابل پروتئين هاي شوک حرارتي با پروتئين هاي ديگر سلولي، تا خوردن مناسب پروتئين هاي هدف و انتقال آن ها را به درون اندامک هاي سلولي تسهيـل مي کند (۵).
شرايط طبيعي و چه تنش محيطي، وابسته به ATP حاصل در دماي ۳۷ درجه براي مدت ۳۰ دقيقه انکوبه شد و
به دليل تأثير آن ها بر روي کنـفورماسيـون پروتئين هاي ديگر، HSP ها را تحت عنوان کاپرون (Chaperone) مولکولي ناميده اند (۲و۵) . اين پروتئين ها علاوه بر نقش کاپروني، سلول را در مقابل آسيب هاي ناشي از استرس هاي محيطي محافـظت مي کننـد (۳ و ۵ و ۶). مهم ترين نقش HSP هاي ۶۰ کيلو دالتوني، کمک به تاخوردگي پروتئيـن هاي تازه انتقال يافته بوده و اين عمل چه در
عمل استخراج، ابتدا با فنل‐ کلروفرم ‐ ايزوآميل الکل (۱: ۲۴: ۲۵) و سپس کلروفرم ‐ ايزوآميل الکل (۱: ۲۴) انجام شد. در ادامه، DNA با افزودن هم حجم از ايزوپروپانول و سانتريفيوژ g × ۱۵۰۰۰ به مدت نيم ساعت رسوب داده شد که رسوب حاصله با اتانول ۷۰% شستشو داده شد و در آب مقطر استريل نگهداري شد.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

• انجام PCR :
براي طراحي پرايمر از توالي هاي مشابه موجود در بانک اطلاعات ژني مرکز ملي اطلاعات بيوتکنولوژي از قارچ هاي مشابه مانند ترايکوفايتون منتاگروفايتيس و نوروسپورا کراسا استفاده شد. به وسيله نرم افزار Gene Runner پرايمرها طراحي شدند و بعد از حصول اطمينان از مناسب بودن پرايمرهاي طراحي شده به شرکت MWG-Biotech آلمان سفارش داده شد.
به طـور خلاصـه، جهـت تکثيـر بخـش اول ژن، يک سوسپانسيون ۵۰ ميکروليتري به ترتيب زير تهيه گرديد:
۱۰ ميکروليـتر 10X PCR Buffer، ۱ ميـکروليـتر dNTPmix، ۲ ميکروليتر 2MgCl ، ۱ ميکروليتر DNA
با غلظت 40ng/µl ، ۵/۲ ميـکرو ليتر از هر يک از پرايمـرها مي باشد (۷). اين گروه از HSP ها در انتقال پروتئين هاي سيتوپلاسمي به داخل ميتوکندري نيز نقش دارند (۸ و ۹).
درماتوفيت ها گروهي از قارچ هاي رشته اي کراتينوفيليک هستند که پوست و ضمائ م پوستي را در انسان و حيوانات مورد حمله قرار مي دهنـد (۱۰). ميـکروسپـوروم کانيس درماتوفيت حيوان دوست است که در سگ و گربه و به ندرت اسب و ميمون ايجاد بيماري مي کند. در انسان اين قارچ باعث کچلي ريش و سبيل، بدن، ناخن و سر مي شود. کچلي مو در انسان به صورت اسپور خارج مويي (اکتوتريکس) مشاهده مي شود، هر چند اين قارچ به پوست بدون مو نيز حمله مي کند (۱۱).
با توجه به اين که در زمينه ژنتيک مولکولي، تحقيقات نسبتاﹰ اندکي روي اين قارچ انجام شده، اين مطالعه با هدف تعيين مولکولي ژن توليد کننده پروتئين هاي شوک حرارتي
۶۰ کيلودالتوني در اين قارچ انجام شد.
مواد و روش ها
جدا سازي DNA :

پس از جداسازي وکشت قارچ مورد نظر، با استفاده از روش تغيير يافته Choi و همکاران، DNA با وزن مولکولي (۳۵ دور) ، oC ۷۲ به مـدت ۵ دقيـقه (يک دور) و oC ۲۰ به مدت ۱ دقيقه (يک دور).
محصولات PCR در نهايت با کمک الکتروفورز با ژل آگاروز ۱% بررسي گرديدند.
توالي يابي قطـعات PCR :
قطعات PCR ابتدا از ژل الکتروفورز جدا و سپس با کمک کيت Qiagen خالص سازي گرديدند. با استفاده از DNA دو رشته اي و پرايمرهاي طراحي شده، توالي يابي
Dye Terminator Cycle با کمک کيت PCR قطعات
(شرکت MWG آلمـان) انجـام شـد. توالي نوکلئـوتيـدي حاصله با توالي ژن هاي مشابه در (NCBI – NIH) مقايسه گرديدند.
يافته ها PCR هر دو بخش ژن با کمک پرايمرهاي طراحي شده انجام گرديدند و قطعات ابتدائي (B) و مياني (A) ژن McHSP60 (تصوير ۱) در کنار سايز مارکر شماره VI
کمپاني Roche بر روي ژل الکتروفورز مـورد تأييد قرار گرفتند.
(۵ ميکروليتر) با غلظت 10pmol) 10ng/µl) و ۵/۱ ميکروليتر آنزيم Taq که مجموعاﹰ در ۵/۲۹ ميکروليتر آب ديونيزه استريل حل مي شوند.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

برنـامـه PCR قطعه ي اول ژن (ميـاني) به شـرح زير انجـام گرديد: oC ۹۴ به مدت ۵ دقيقه (يـک دور)، oC ۹۴ به مدت ۱ دقيقه، oC ۵۰ به مدت ۱ دقيقه و oC۷۲ به مدت ۱ دقيقه و سي ثانيه (۳۵ دور)، oC ۷۲ به مدت ۷ دقيقه (يک دور) و oC ۲۰ به مدت ۱ دقيقه (يک دور).
ه م چنـين براي تکـثير بخـش دوم ژن (ابتـدايي)، سوسپانسيون ۵۰ ميکروليـتري ديگري به قرار زير تهيـه شد:
۱۰ ميکروليتر بافر 10X PCR Buffer، ۱ ميکروليتر dNTPmix، ۲ ميکروليتر 2MgCl، ۲ ميکروليتر DNA با غلظت 40ng/µl ، ۵/۲ ميکروليتر از هر کدام از پرايمرها (۵ ميکروليتر) با غلظت 10pmol) 10ng/µl) و ۱ ميکروليتر آنزيم Taq که مجموعاﹰ در ۲۹ ميکروليتر آب ديونيزه استريل حل مي شوند.
برنامه PCR قطعه دوم ژن به صورت زير انجام شد:
oC ۹۴ به مدت ۵ دقيقه (يـک دور)، oC ۹۴ به مدت ۳۰ ثانيه، oC ۵۴ به مدت ۳۰ ثانيه و oC۷۲ به مدت ۱ دقيقه

57153316427

B (Lane 2): 700 bp A(Lane 1): 1200 bp

تصوير ١ ‐ محصول PCR الکتروفورز شده از قط عه مياني (A) و قط عه ابتدائي (B) ژن (Roch, Germany) VI: HSP 60 وزن مولکولي سايز مارکر شماره M
۵۱۶
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

1 K G R N V L I E S S Y G S P K I T K 18
1 aag gga agg aat gtt ttg att gag tct tca tac ggc tcc cca aaa att act aaa g 55
56 gtatgccgtcaatttgcgcgatactctcacttaccgcggatagctaactccaaatatag 114
19 D G V T V A K A I S L Q D K F E N L G A 38
115 ac ggt gtc acg gtt gcc aaa gct atc tca ttg caa gac aaa ttc gag aat ctc ggc gcc 173
39 R L L Q D V A S K T N E V A G D G T T T 58
174 cgt ctt ctc caa gac gtt gct tcc aag aca aac gag gtc gcc ggt gac ggt acc aca acg 233
59 A T V L A R A I F S E T V K N V A A G C 78
234 gcg acc gtg ctt gca cgt gct atc ttt tcc gag acc gtc aag aat gtt gct gct ggc tgc 293
79 N P M D L R R G I Q A A V D S V V E Y L 98
294 aac cca atg gac ttg aga aga ggc att cag gcc gcc gtt gac tcc gtc gtc gaa tat ctt 353
99 Q A N K R E I T T S E E I A Q V A T I S 118
354 caa gca aat aag aga gag atc acc acc agc gaa gag att gcg cag gtg gct acg atc tct 413
119 A N G D T H I G K L I S N A M E R V G K 138
414 gct aac ggg gac acc cat atc gga aag ttg atc tcc aac gca atg gaa aga gtt gga aag 473
139 E G V I T V K D G K T I E D E L E V T E 158
474 gaa ggt gtg att acg gtt aag gac gga aag acc att gaa gac gag ctt gag gtt acc gag 533
159 G M R F D R G Y V S P Y F I T D P K T Q 178
534 ggc atg cga ttt gac cgc ggc tat gtt tcc cct tac ttt atc acc gac ccc aaa act cag 593
179 K V E F E K P L I L L S E K K I S A V Q 198
594 aag gtt gag ttt gaa aag cct ctt att ctc ctc tct gag aag aag atc tct gcc gtc cag 563
199 D I I P A L E A S T T L R R P L V I I A 218
654 gat att atc ccc gcc ctt gag gcc tct acc acc ctc cgc cga cca cta gtt atc att gct 713
219 E D I E G E A L A V C I L N K L R G Q L 238
714 gag gat att gag ggc gag gct ctc gca gtc tgc att ctc aat aaa ctg cgt ggc caa ctt 773
239 Q V A A V K A P G F G D N R K S I L G D 258
774 caa gtc gct gcc gtc aag gct cct ggc ttc ggt gat aac cgc aag agc atc ctt ggt gac 833
259 I A V L T N G T V F T D E L D M K L D K 278
834 att gcc gtc ttg acc aat ggt acc gtg ttc aca gat gag ctt gat atg aag ctt gac aag 893
279 A T P D M L G S T G S I T I T K E D T I 298
894 gct acc cca gat atg ctc ggc tcc acg ggc tcc atc acc atc acc aag gag gac act att 953
299 I L N G E G S K D A I A Q R C E Q I S G 318
954 atc ctg aac ggt gag ggc tcc aag gat gcc att gct cag agg tgc gag caa att agc ggc 1013
319 I I A D P A T S E Y E K E K L Q E R L A 338
1014 atc att gct gat cct gcc acc tcc gaa tac gag aag gag aag ctt cag gag cgt cta gct 1073
339 K L S G G V A V I K V G G A S E V E V G 358
1074 aaa ctc tct ggt ggt gtt gct gtc atc aag gtc ggc ggt gct tct gaa gtt gaa gtt gga 1133
359 E K K D R V V D A L N A T R A A V E E G 378
1134 gag aag aag gac cgt gtt gtt gat gcc ctg aac gct acc cgc gct gct gtt gag gag ggt 1193
379 I L P G G G T A L L K A S A N G L K D V 398
1194 att ctc ccc ggc ggt ggt acc gcc ttg ctc aag gct tcc gcc aat ggt ttg aaa gac gtc 1253
399 K P A N F D Q Q L G V S I V K N A I Q R 418
1254 aag cca gcc aac ttt gac cag cag ctg ggt gtc agc att gtt aag aac gcc atc cag aga 1313
419 P A R T I V E N A G L E G S V I V G K L 438
1314 cct gct cgt act att gtt gag aat gct ggg ttg gag ggt agc gtc att gtg ggc aag ctt 1373
439 T D E F A D D F N R G F D S A K G E Y V 458
1374 aca gat gaa ttt gcg gac gat ttc aat aga ggc ttc gat agc gcc aag gga gag tac gtt 1433
459 D M I Q A G I V D P L K V V R T A L V D 478
1434 gat atg atc cag gct gga att gtc gac cca ttg aag gtt gtt cgc acc gct ctc gtc gat 1493
479 A S G V A S L L G T T E V A I V E A P 497
1494 gcc agt ggt gtt gca tcc cta ctc ggt acc acc gag gtt gca atc gtt gaa gct ccc 1550

تصوير ٢ ‐ توالي نوکلئوتيدي و پروتئيني ژن HSP 60 در ميکروسپورو م کانيس

تـوالي نوکلئـوتيـدي و پـروتئيـني ژن McHSP60 اين قارچ مورد مطالعه دقيق قرار گرفته است و رشد موتان ها
فاقد اين ژن در محيط هاي مختلف نيتروژن دار بررسي گرديده اند (۱۴).
پروتئين هاي شوک حرارتي يا HSP ها، کاپرون هاي مولکولي بوده و از طريق کنترل تا خوردگي پروتئين هاي تازه توليد شده، در انتقال آن ها به درون اندامک هاي سلولي نيز دخالت دارند ضمن اين که سلول زنده را در مقابل تنش هاي محيـطـي نـظير تابـش فرا بنـفش ، املاح فلـزات سنگين و شوک هاي گرمائي مقاوم مي سازند (۳‐۱ و ۵).
به نظر مي رسـد که HSP، ۶۰ کيـلودالتـوني در تجـمع پروتئين ها نيز دخالت داشته باشد (۱۵). با استفاده از جهش يافتگان فاقد HSP60، مشخص شده که فقدان اين پروتئين باعث تغيير در مرفولوژي DNA ميتوکندري مي شود (۱۶).
HSP60 مي تواند به عنوان ادهسين اختصاصي ماکروفاژها نيز عمل کند (۱۷). يک ژن رمز کننده HSP60 از قارچ Paracoccidioides brasiliensis به دسـت آمـده که حاوي ۲ اينترون است و پروتئيني را با ۵۹۲ آمينو اسيد کد مي کند (۱۸).
Roska و همـکـاران، ژن سـنـتـز کـنـنـده HSP60 را در قـارچ T.mentagrophytes مـورد مطالعه قرار داده اند.
.(NCBI , NIH : AF199024 )
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

در مطالعه اخير، براي بررسي ژن McHSP60 که داراي توالي اگزوني و اينتروني است از پرايمرهاي اليگونوکلئوتيدي استفاده شده که بخشي از اين ژن را که مشتمل بر اگزون و اينترون مي باشد تکثير نموده است. اين ژن در حال حاضر داراي ۱۵۵۰ نوکلئـوتيـد است کـه پروتئيـني را با ۴۹۷ به دست آمده، در تصوير ۲ مشخص است. اين توالي شامل ۱۵۵۰ نوکلئوتيد است که پروتئيني با ۴۹۷ آمينواسيد را رمز مي نمـايد. مقايـسه توالي نوکلئـوتيـدي ژن مـورد نظـر در Genbank آمريـکا همـولـوژي معـني داري را بـا سـاير HSP هاي يـوکاريـوتي۶۰ کيلودالتوني نشان مي دهد. توالي آمينواسيدي پروتئين ساخته شده، بيش از ۹۷% با Coccidioides immitis و بيش از ۹۲% با Aspergillus fumigatus همولوژي نشان مي دهد تجزيه و تحليل پروتئين حاصله که از اين به بعد به صورت McHSP60 معـرفي مي شـود بيانگر غنـي بودن آن از گلايسين، آلانين و گلوتاميک اسيد بوده و در مقابل مقدار تريپتوفان و سيستئين آن ناچيز است.
ژن سکانس شده از قارچ ميکروسپوروم کنيس به عنوان يکHSP 60 ، به بانک اطلاعات ژني مرکز ملي اطلاعات بيـوتکنـولوژي (NCBI) در آمريـکا ارائـه و با شمـاره
.ثبت گرديد DQ981834
بح ث
شـناسائي گونه هاي ميکروسپوروم را از طريق PCR آمينواسيد رمز مي نمايد. از نظر توالي نوکلئوتيدي، و PCR-RFLP با کمک ژن DNA‐ توپوايزومراز II اين ژن شباهت بسيار زيادي با ژن هاي HSP60
به طـور کلي، درماتوفيـت ها داراي ۳ جنـس مهـ م Microsporum ،Trichophyton و Epidermophyton مي باشنـد که تاکنـون تحقيـقات مولکـولي روي جنـس اپيدرموفايتون ک م تر از دو جنس ديگر انجام شده است. قارچ مورد مطالعه يعني M.canis از عوامل حيوان دوست بوده که در انسان نيز کچلي ايجاد مي کند اما کچلي کشاله ران و دست و پا را به ندرت ايجاد مي کند (۱۱).
يوکاريوت هاي ديگر داشتـه به طـوري که بيـش از ۹۷% با
و بيـش از ۸۲% بـا Coccidioides immitis
Aspergillus nidulans همولوژي نشان مي دهد. HSPها تاکنـون در موجودات مختلفي ه م چون قارچ ها، انجام داده اند (۱۲). البته نوع خاصي از PCR به نام Inter-single-sequence-repeat-PCR) ISSR-PCR) در تشخيص M.canis مورد استفاده قرار گرفته است (۱۳).
در مطالعه اي جديد، ژن تنظيم کننده مصرف نيتروژن در آن ها که فعاليت آنتي ژنيـک دارند، به عنـوان اهـدافي براي پاسـخ هاي ايمني سلولي و هومورال محسـوب مي شـوند
.(۱۹‐۲۳)
۵۱۸
انسان، مگس سرکه و کرم ها مورد مطالعه قرار گرفته اند.
اين پروتئين ها در ايجاد پاسخ هاي ايمني مختلف، چه ضد ميکروبي و چه خود ايمني در ميزبان مؤثر هستند و انواعي از

REFERENCES

Trautinger F. 72-kDa heat shock protein is a mediator resistance to ultraviolet B light. J invests Dermatol 1995; 105: 160-2.
Linqusit S, Craig EA. The heat shock proteins. Ann Rev Genet 1988; 22: 631-7.
Leppa S. Heat shock response – pathophysiological implication. Ann Med 1997; 29: 73-8.
Steen BR, Lian T, Zuyderduyn S, MacDonald WK, Marra M, Jones SJ, et al.
Temperature-regulated transcription in the pathogenic fungus Cryptococcus neoformans.
Genome Res 2002; 12(9):1386-400.
Hartl FU. Molecular chaperones in cellular protein folding. Nature 1996; 381: 571-80.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:13 +0330 on Wednesday January 10th 2018



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید