پژوهن ده (مجله پژوهشي دانشگاه علوم پزشکي شهي د بهشتي)
سال دوازده م, شماره ۲, پي در پي ۵۶ ، صفحات ۱۰۷ تا ۱۱۴ تاريخ دريافت مقاله ٤/٦/٨٥
تاريخ پذيرش مقاله ١٥/٩/٨٥ خرداد و تير ۱۳۸۶

ج دا سازي اشرشياکلي مول د شيگا توکسين (STEC) در نمونه هاي گوش ت
جمع آوري ش ده از تهران با روش PCR و بررسي ا لگوي مقاوم ت
آنتي بيوتيکي سويه هاي ج دا ش ده
۵۴۳۲* ۱
فهي مه باغباني آراني ، دکتر سياو ش سل مانزاده اهرابي ، فرشته ج عفري ، عف ت حبيبي ، دکتر مح مد رضا زالي

چکي ده
سابقه و ه دف: باکتري اشرشياکلي مولد توکسين شيگا ( STEC)، به عنوان يک پاتوژن ناشي از غذا از نظر سـلامت عمـومي در دنيا مهم بوده و در بسياري از همه گيري ها و موارد تک گيـر، گـزارش شـده اسـت . مطالعـات در کـشورهاي مختلـف بيـانگر آن است که احتمال آلودگي مواد غذاي با اين پاتوژن وجود دارد . مطالعه حاضر، با هـدف بررسـي فراوانـي آلـودگي نمونـه هـاي گوشت در تهران با STEC، تعيين ژنوتيب باکتري هاي جدا شده وارزيابي الگوي مقاومت آنتي بيوتيکي آن ها، انجام شد.
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:14 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:14 +0330 on Wednesday January 10th 2018

مواد و روش ها: در اين مطالعه توصيفي دويست و پنجاه نمونه گوشت خام از قصابي هاي مناطق مختلف تهران در طي مدت يک سال از تاريخ ۱/۳/۱۳۸۳ تا ۱/۳/۱۳۸۴ جمع آوري و براي جدا سازي STEC از نمونه هاي گوشت، از روش هاي معمولي کشت و تشخيص ملکولي PCR استفاده شد. سپس الگوي مقاومت آنتي بيوتيکي سويه ها با روش استاندارد انتشار ديسک تعيين گرديد.
يافته ها: از بين ٢٥٠ نمونه، ٤٧(۸/۱۸%) نمونه PCR مثبت بودند ولي فقط٣٠ (١٢%) سويه با موفقيت جدا شد، که از بين آنها،
٢٤(٨٠%) سويه داراي ژن 2stx ، دو سويه (۷/۶%) هم ژن 2stx وهم 1stx را داشته و ٤ (۳/۱۳%) سويه داراي 2stx و eae مثبت بودند. در تست مقاومت آنتي بيوتيکي همه سويه ها به جنتامايسين، نوروفلوکساسين، انروفلوکساسين، ايمي پنم، ناليديکسيک اسيد، سيپروفلوکسازين و سفتازيديم حساس بودند. درصد مقاومت به آنتي بيوتيک ها عبارت بود از:
اولندومايسين ١٠٠%، اريترومايسين١٠٠%، سفالوتين۶۷%، آموکسي سيلين‐کلاولانيک اسيد ٦/٤٦%، کلروتتراسايکلين٣/١٣%، تتراسايکلين۱۰%، استرپتومايسين۶/۶%.
نتيجه گيري: يافته هاي اين مطالعه نشان مي دهد که امکان آلوده بودن گوشت خام با STEC و مقاوم بودن اين باکتري با عوامل آنتي بيوتيکي وجود دارد و اقدامات پيشگيرانه به منظور جلوگيري از آلودگي گوشت با اين باکتري لازم مي باشد.
واژگان کلي دي: STEC ، گوشت ، PCR، مقاومت آنتي بيوتيکي

مق دمه
اشرشيا کلي مولد توکسين شيگا STEC يک پاتوژن مه م باکتري دانـسته انـد (۱و۲). آلـودگي بـااين ارگانيـس م باعـث
در بيماري هاي ناشـي از غـذا مـي باشـد و تـاکنون چنـدين اسهال آبکي و خوني مي شود و ازعـوارض بعـدي عفونـت بـا همه گيري ناشي از غذا در سراسـر جهـان را مـرتبط بـا ايـناين باکتـري به ويـژه با سروتيپ O157:H7 آن، مي توان

۱ ٭ . نويسنده مسؤول : کارشناس ارشد ژنتيک،عضو باشگاه پژوهشگران جوان(دانشگاه آزاد اسلامي)،محقق مرکز تحقيقات گوارش و کبد،دانشگاه علوم پزشکي شـهيد بهشتي. آدرس: تهران، ولنجک، بيمارستان طالقاني، مرکزتحقيقات گوارش و کبد،بخش Food born. پست الکترونيکي: [email protected]۲ . استاديار، مرکز تحقيقات گوارش و کبد،دانشگاه علوم پزشکي شهيد بهشتي
۳ . کارشناس ميکرو بيولوژي، محقق مرکز تحقيقات گوارش و کبد،دانشگاه علوم پزشکي شهيد بهشتي
۴ . کارشناس ارشد ميکرو بيولوژي، محقق مرکز تحقيقات گوارش و کبد،دانشگاه علوم پزشکي شهيد بهشتي
۵ . استاد،رئيس مرکز تحقيقات گوارش و کبد،دانشگاه علوم پزشکي شهيد بهشتي
۱۰۸ / ماهنامه
قرمــز در طــي مــدت يــک ســال از تــاريخ ۱/۳/۱۳۸۳ تــا ۱/۳/۱۳۸۴ با رعايت توزيـع متناسـب تعـداد نمونـه در پـنج به کوليت هموراژيک و سندرم اورميک هموليتيک اشاره کرد(۳).
بيش از صد سروتيپ از E.coli شناسايي شده است که منطقه شمال، غرب، شـرق، مرکـز و جنـوب شـهر تهـران، ازتوانايي توليد شيگا توکسين را داشته و داراي يکي از قصابي هاي اين مناطق به طـور تـصادفي جمـع آوري و ايـن
ژن هاي stx1 يا 2stx يا هر دو آنها و يا واريانت هايي از نمونه برداري از گوشت ها به صـورت تکـه اي و چـرخ کـرده2stx هستند که محل اين ژنها بر روي باکتريوفاژ ليزوژنيک صورت گرفت . نمونه هاي تهيه شده روي يـخ نگهـداري و بـهمي باشد. علاوه بر توليد توکسين، ديگر فاکتور ويرولانس آزمايــشگاه انتقــال داده شــدند . ۲۵ گــرم از هــر نمونــه در مرتبط باSTEC ، پروتئيني به نام Intimin با وزن ملکولي ml ۲۲۵ محـــيط غنـــي کننـــ ده EC-broth حــــاوي
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:14 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:14 +0330 on Wednesday January 10th 2018

94-KDa و موجود در غشاي خارجي باکتري است که آنتي بيوتيک نووبيوسين (100mg/ml) قرار داده شده و بـامسئول چسبندگي به سلولهاي اپيتليوم روده مي باشد و دستگاه Stomacher هموژنيزه گرديد. سپس به مـدت ۲۰ توسط ژن eae رمز مي شود (۴). ساعت دردماي° ۳۷ انکوبه شد. µg۱۰۰ از محيط غني شده آلودگي انسان با اين باکتري از طريق مصرف مواد غذايي وEC-broth پس از انکوباسيون در پپتون واتر (کلريد سدي مآب آلوده يا انتقال شخص به شخص صورت مـي گيـرد (٥) و ۵% و ۱% تريپتون) رقيق شده و بعد روي محيط مک کـانکيتـاکنون حـضور STEC در چنـ دين مـاده غـ ذايي از جملـه آگار برده و يـک روز دردمـاي ° ۳۷ انکوبـه گرديـد. سـپسگوشـت قرمـز و گوشـت مـاهي گـزارش شـ ده اسـت (۶و۷). مقداري از باکتري موجود در ناحيه اوليه کـشت روي محـيطدر حالي که در کشورهاي پيشرفته، مطالعـات زيـادي انجـام مک کانکي آگار را برداشته و استخراج DNA از آن بـا روششده است در مـورد وضـعيت ايـن بـاکتري در کـشورهاي در جوشاندن انجام شد.
حال توسـعه، اطلاعـات در مـورد بـسيار محـدود مـي باشـد. دو واکنش متمايز PCR با پرايمرهاي اختصاصي ژن هاي از سوي ديگر با توجه به اينکه يکي از روشهاي درماني بـراي1stx2 ، stx براي هر نمونه انجـام شـد(۹). محـصول PCR
آلودگي با اين باکتري، تجويز آنتي بيوتيک ها مي باشد (۸) و
روي ژل آگــــارز ۳/۱ % الکتروفــــرز شــــ ده و ســــپس
مقاومت باکتريها به عوامل آنتـي بيـوتيکي در حـال افـزايش
بــــا اتيــــ ديوم برمايــــ د رنــــگ آميــــزي گرديــــ د.
روزافزون است، بررسي حساسيت آنتـي بيـوتيکي سـويه هـا از Escherichia coli EDL933 بعنوان کنتـرل مثبـت
به منظور به تعيين راهکارهاي درماني مناسب، لازم مي باشد. در PCR استفاده گرديد. سپس براي تعيين کلون هاي مؤثر بر اين اسـاس، مطالعـه حاضـر بـا هـدف تعيـين فراوانـي در مثبت شدن PCR اوليه، PCR هاي بعـدي روي DNA
آلودگي در نمونه هاي گوشت جمع آوري شـده در تهـران بـا
استخراج شده از کشت خالص حاصـل از کلـوني هـاي اوليـه
باکتري اشرشيا کلي مولـد شـيگا توکـسين، تعيـين ژنوتيـپ انجام گرفت . در مرحله بعد سويه هـاي بدسـت آمـده توسـط
تست هاي بيوشيميايي به عنوان E.coli تاييد شـدند. بـرايتعيين وضعيت ژن eae در سويه هاي جداشـده، PCR روياين ژن ه م انجام شد (۱۰). ژن هاي هدف، توالي پرايمرهـا و طول قطعه تکثير شده در جدول شماره ۱ آورده شده است.
براي تعييـن حساسيت سويه هاي STEC بدست آمـده آن ها و نيز بررسي الگوي مقاومت آنتي بيوتيکي سويه هـايجدا شده انجام شده است.
مواد و روشها
در اين مطالعـه توصيـفي، دويست و پنـجاه نمونه گوشت
,
1268731734566Downloaded from pajoohande.sbmu.ac.ir at 10:14 +0330 on Wednesday January 10th 2018

Downloaded from pajoohande.sbmu.ac.ir at 10:14 +0330 on Wednesday January 10th 2018

نسبت به داروهاي آنتي بيوتيک، روش ديسک ديفوزيـون بـراساس استاندارد Kirby-bauer و بـرروي محـيط آگـار دار مولر هينتون صورت گرفت (۱۱). براي اين منظور، مقداري ازکلني باکتري از کشت خالص روي محيط مـک کـانکي آگـاروارد محيط کشت TSB شده و به مـدت ۲ تـا ۴ سـاعت دردماي ° ۳۷ تا مشاهده يک کدورت واضح منطبق با کـدورتاستاندارد ۵/۰ مک فارلند، انکوبه گرديد. پس از آن قطر هالـه
عدم رشد برحسب ميلي متر اندازه گيري شده و با استفاده از جدول استاندارد NCCLS، ميزان حساسيت باکتري نسبتبه آنتي بيوتيک به صورت حـساس، نيمـه حـساس و مقـاومگزارش شد. E.coli ATCC25222 بعنوان کنترل کيفـي
جدول۱ ‐ ژنهاي هدف، توالي پراي مرها و طول قط عه تکثير شده
(bp) PCR طول محصول (’3-’5) توالي پرايمر ژن هدف
٨٩٤ CAGTTAATGTGGTGGCGAG CTGCTAATAGTTCTGCGCTC stx1
٤٧٨ CTTCGGTATCCTATTCCCGG
GGATGCATCTCTGGTCATG stx2
٦٢٩ TGCGGCACAACAGGCGGCA
CGGTCGCCGCACCAGGATC eae

ديسک ها استفاده گرديد. ديسک هاي آنتي بيوتيکي به کـاررفتــه عبــارت بودنــد از: استرپتومايــسين، اولندومايــسين، جنتامايــــسين، نوروفلوکــــسا ســــين، انروفلوکــــساسين، اريترومايسين، آموکسي سيلين کلاولانيک اسيد، ايمـي پـن م،کلروتتراســـايکلين، تتراســـايکلين، ناليديکـــسيک اســـيد،سيپروفلوکساسين، سفتازيدي م و سفالوتين.
سپس اطلاعات حاصله توسط نـرم افـزار SPSS نـسخه۵/۱۱ با استفاده از تست مربع کاي يا دقيـق فيـشر تجزيـه وتحليــل شــد و P-value کمتــر از ۰۵/۰ از نظــر آمــاري معني دار تلقي گرديد.

يافته ها
از ۲۵۰ نمونه گوشت گاو مورد آزمايش ۴۷ (۸/۱۸%) نمونه در تست PCRمثبت بود. اما در اين مطالعه تنها ۳۰ (۱۲%) سويه با موفقيت خالص گرديد. فراواني STEC در نمونه هاي گوشت در مناطق مختلف تهران در نمودار ۱ نشان داده شده است. بطوري که بيشترين فراواني در مرکز (۵/۲۵%) و ک م ترين فراواني در شرق (۸/۱۲%) ديده شد. اما رابطه معني داري بين فراواني STECدر گوشت و منطقه جمع آوري نمونه ها وجود نداشت. درصـد حضور STECدر

23.
4

1
19.

12.8

19.
1

25.5
0

5

10

15

20

25

30

مال
ش

رب
غ

شرق

وب
ن
ج

رکز
م
فراوان

صد

در
ی

23.



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید