پژوهنده )مجله پژوهشي دانشگاه علوم پزشکي شهيد بهشتي( تاریخ دریافت مقاله: 3/6/1395
سال بيست و یکم، آذرشماره و5 ، دیپي 5در 9پي 313 11، صفحات 320 تا 326 تاریخ پذیرش مقاله: 10/3/1396
ارتباط چند شکلي های ژن نيتریک اکسيد سنتاز اندوتليالي با سندرم سقط مکرر
فاطمه شاکرمي1، فهيمه عليزاده2، دکتر شهره زارع کاریزی*3، دکتر محمد تقي اکبری5،4، دکتر رضا ميرفخرایي6

کارشناس ارشد ژنتيک، گروه زیست شناسي، دانشگاه گيلان، رشت، ایران
کارشناس ارشد ژنتيک، گروه زیست شناسي، دانشگاه آزاد اسلامي واحد دامغان، دامغان، ایران
استادیار گروه زیست شناسي، دانشکده علوم زیستي، دانشگاه آزاد اسلامي واحد پيشوا، ورامين، ایران
استادیار گروه ژنتيک پزشکي، دانشکده پزشکي، دانشگاه تربيت مدرس، تهران، ایران
آزمایشگاه ژنتيک پزشکي تهران- دکتر اکبری، خيابان طالقاني، پلاک 251
-10921208627

استادیار گروه ژنتيک پزشکي، دانشکده ی پزشکي، دانشگاه علوم پزشکي شهيد بهشتي، تهران، ایران چکيده
سابقه و هدف: سقط مکرر به معني از دست دادن سه یا بيش از سه بارداری قبل از هفته بيستم حاملگي است که حدود 1 تا 5% زناانباردار را تحت تأثير قرار مي دهد. نيتریک اکسيد سنتاز اندوتليالي )eNOS( آنزیمي است که در طي بارداری روی گنادوتروپين جنينا ي اثر مي گذارد. مطالعات قبلي وابستگي بين فعاليت eNOS و بارداری را نشان داده است، اما امروزه ارتباط بين چند شکلي های این ژن و سندرم سقط مکرر اختلاف نظر وجود دارد. در این مطالعه ارتباط بين پلي مورفيسام rs1799983 ،rs1177443 و VNTR اینتارون 4 ژن eNOS با سقط مکرر جنين بررسي شده است.
مواد و روش ها: این مطالعه روی 80 خانم با سابقه دو یا سه سقط مکرر با علت ناشناخته به عنوان گروه بيمار و 80 خانم که حداقل دو بارداری موفق داشته و هيچ زمينه ای از سقط نداشتند به عنوان گروه کنترل صورت گرفات. پاا از اساتخرا DNA حضاور یا ا عادمحضور SNPهای مذکور توسط تکنيک PCR-RFLP با استفاده از آنزیم های محدودالاثر MnlI و BanII به ترتيب بررسي شد. ساساداده ها با استفاده از نرم افزار SPSS18 و آزمون مربع کای تجزیه و تحليل شد.
یافته ها: نتایج این مطالعه نشان داد که تفااوت معناي داری ميا ان پلا ي مورفيسام هاا ی جایگااه rs1799983 ،)p=0/16( rs11771443
)15/0=p( و VNTR اینترون 4 )48/0=p( ژن نيتریک اکسيد سنتاز اندوتليالي در گروه بيمار و گروه کنترل وجود ندارد.
نتيجه گيری: طبق نتایج به دست آمده، ارتباط معن يداری ميان سه پلي مورفيسم مذکور ژن نيتریک اکسيد سانتاز انادوتليالي و ساقطمکرر وجود ندارد.

-17982225807

واژگان کليدی: ژن نيتریک اکسيد سنتاز اندوتليالي، پلي مورفيسم، سقط مکرر، شل شدن عضلات صاف لطفاً به این مقاله به صورت زیر استناد نمایيد:
Shakarami F, Alizadeh F, Zare Karizi S, Akbari MT, Mirfakhraei R. The relationship between polymorphisms of
Endothelial Nitric Oxide Synthase gene and recurrent abortion syndrome in Iranian female’s population. Pejouhandeh :)6(12;6102320-326.
5083465

مقدمه1
یکي از معدود مشکلاتي که زندگي زو های جوان را درگير کرده و جزو شایع ترین عوارض حاملگي مي باشد، مسأله ساقطجنين است )1(. از نظر تعریف، ساقط خاتم حااملگي قبال ازهفته بيستم، اطلاق مي شود )2(. سقط خود به خودی از لحاظ باليني انواع مختلفي دارد که یکي از آن ها سقط مکرر مي باشد و به طور کلاسيک بدین گوناه تعر یا ف ما ي گاردد : ساه ساقط

*نویسناده مسؤول مکاتبات: دکتار شاهره زارع کااریزی؛ گاروه ز یسات شناسا ي، دانشکده علاوم زیستاي، دانشگاه آزاد اسلامي واحد پيشاوا، وراميان، ایا ران؛ تلفان:
[email protected] :پست الکترونيک ،)021( 88896868-9
مت والي ی ا بيش تر قب ل از هفت ه بيس تم ب ارداری و ی ا تول د جنين هایي کمتر از 500 گرم )3،4(.
حدود 1 تا 5 درصد خانم های باردار ساقط مکارر را تجرباهمي کنند که ممکان اسات باه دليا ل نارساا یي هاا یي همچاوناختلالات هورموني، عوامل ایمونولوژیک، عوامل عفوني، عوامالمحيطي، عوامال آنااتوميکي، عوامال ترومباوفيلي و اخاتلالاتژنتيکي از جمله ناهنجاری های کروموزومي و تاک ژناي باشا د. این در حالي است که درصد قابال تاوجهي از عوامال ماؤثر در سندرم سقط مکرر ناشناخته باقي مانده است. در ميان عوامالشناخته شده سقط مکرر، عوامال ژنت يکا ي شاا ی عتار ین عامالاست. در مطالعات ژنتيکي مختلف ارتباط با ين ساقط مکارر وپلي مورفيسم های ژنتيکي مرباوط باه بازکننادهها ای عاروق ازجمله نيتریک اکسيد سانتاز انادوتليالي )eNOS( نشاان دادهشده است )5(.
یک حاملگي طبيعي به گردش مناسب خون جفت و عاروقجنين وابسته است و عملکرد طبيعي عروق نيازمناد همکاار ی پيچيده بين سلول ها و فاکتورهای رشد مختلف در فرآینادها ی لانه گزیني، رشد جنين و تشاک يل جفات اسات )6(. مطالعااتمختلف به نقش آسا يب انادوتل يال و اخاتلال عاروق جفات درپاتوژنز سقط اشاره مي کند. ژن eNOS به عنوان منباع تول يا د نيتریک اکساید )NO( که نقش مهمي در فيزیولاوژ ی عاروق واختلال عروق جفتي دارد در نظار گرفتاه شاده اسات )7(. در سال های اخير NO به عنوان یک ميانجي مهم در فرآینادها ی بيولوژیکي متعدد از جمله عروق، ایمني و توليد مثال شاناختهش ده اس ت و در ط ول ب ارداری س ه عملک رد مه م اتس اع و گشادسااازی عااروق مااادر، کنتاارل جریااان خااون رحاام وفيتوپلاسنتال و آرامش رحم قبل از زایمان را بر عهده دارد .
علاوه بر این، مطالعات آزمایشگاهي اخيا ر در جونادگان باهاین موضوع اشاره مي کناد کاهNO ناه تنهاا از طریا ق اتسااععروق مادری و شلکنندگي عضلات صااف باه حفاا باارداری کمک مي کند، بلکه ممکن است در مهار سيستم ایمنا ي نقاشداشته باشد و به عنوان یک تنظي مکنندهی رشد و نما و جنا ين عمل کند )8(. در یک حاملگي طبيعي، مسير NO فعال باوده و ميزان دسترسي به NO را افزایش مي دهد. مطالعات مختلف نشان مي دهد که کاهش توليد NO مي تواند منجر باه اخاتلالدر خونرساني جفت و عرضهی مواد غاذا یي با اه جنا ين شاود )9-1(. اختلالات عروقي جفت ممکن است منجا ر باه عاوارضحاملگي نظير سقط و پره اکلامسسي شود )12(.
ژن eNOS در موقعي ت کروم وزومي 36-q357 ق رار دارد )6،7(. این ژن دارای 26 اگزون است کاه در حادود kbp21 از DNA ژنااوم ي را در برما يگيا رد )10-8(. پلا ي مورفيسا م Glu298Asp در اگاازون 7 ژن eNOS قاارار دارد و یکااي از شایع ترین چند شکلي های ایا ن ژن اسات. نوکلووت يا د گاوان ين )G( در موقعي ت 894 ج ایگزین تيم ين )T( م ي ش ود ک ه درنتيجه گلوتاميک اسيد در کدون 298 باه آساسارتيک اسا يد تبدیل مي شود. پلي مورفيسم rs11771443 دارای دو آلل C و T است که در پروماوتر ایا ن ژن قارار دارد. در پلاي مورفيسام VNTR اینترون 4، 27 جفت باز به اینترون 4 اضافه یا حذف ما ي ش ود. آل ل غالابb اس ت )ط ول اینت رون bp420( و در صورت حذف این توالي bp27، آلل a بروز پيدا مي کند )طاولآلل bp ،a320( است) 6،11(.
در سال های اخير توجه زیادی به بررسي ارتباط با ين چنادشااااکلي هااااای ژن rs1799983 ،rs11771443( eNOS و VNTR اینترون 4( با سقط مکرر شده است. از آنجا که نتایج واحدی از این مطالعات حاصل نشده است، لاذا مطالعاهی ایا ن عوامل و ارتباط آن ها با سقط مکارر جنا ين، همچناان یکا ي از موضوعات مورد علاقه پژوهشگران اسات . در مطالعاه ی حاضارارتباط سه پلي مورفيسم مذکور در ژن نيتریک اکسيد سنتاز با سقط مکرر بررسي شده است.

مواد و روش ها
در این مطالعه مورد- شااهد ی، 80 خاانم مباتلا باه ساقطمکرر جنين با ميانگين و انحراف معيار سن 03/5±7/27 ساالکه حداقل 2 یا تعداد بيشتری ساقط قبال از هفتاه ی بيساتم بارداری داشته و فاقاد مشاکلات آنااتوميکي رحام، مشاکلاتژنتيکي، مشکلات ایمونولوژیک، مشکلات هورموني و مشکلات عفوني بوده اند، به عنوان گروه بيمار انتخاب شدند. این زنان در طي سال های 1389 الي 1393 به آزمایشگاه ژنتيا ک پزشاک ي تهران مراجعه کرده بودند. در مقابال، 80 خاانم باا حاداقل 2 تولد موفق بادون هايچ ساابقه ای از ساقط، باه عناوان شااهدانتخ اب ش دند. مي انگين و انح راف معي ار س ن ای ن اف راد
66/4±30 سال بود.
پا از دادن آگاهي و کسب رضایت نامه، 5 ميلي ليتار خاونمحيطي از افراد بيماار و شااهد در لو لاه هاا ی حااو ی EDTA گرفته شد. استخرا DNA ژنوميا ک از لکوسا يت هاا ی خاونمحيطي، با استفاده ازروش نماک اشاباع انجاام شاد. واکانشزنجيره ی پليمراز با استفاده از پرایمرهای اختصاصي بارا ی هارچند شکلي انجام گرفت )توالي پرایمرها در جدول 1 ارایه شده اساات(. واکاانش PCR در حجاام 10 ميکروليتاار حاااوی 50 نانوگرم DNA ژنوميک، XPCR Buffer1، 25/0 ميلي مولار از هر dNTPs، 5/1 ميلي مولار 2MgCl، 3 پيکو ماول از هارپرایمر و 1 واحد آنزیم Taq DNA polymerase )سا يناژن، ایران( صورت گرفت. تکثيا ر در 30 سا يکل، دماا ی 95 درجاهسانت يگراد به مدت 50 ثانيه، 64 درجه سانت يگاراد باه مادت50 ثانيه، و 72 درجه سانت يگراد به مدت 50 ثانيه انجام شاد.
دناتوراسيون اوليه به مدت 5 دقيقه در 95 درجه سانت يگاراد و طوی لسازی نهاا یي باه مادت 10 دقيقاه در دماا ی 72 درجاهسا انت يگا راد صا ورت پا ذیرفت. جها ت تعيا ين ژنوتيا پ پل ي مورفيس م ه ای rs11771443 و rs1799983، محص ول
PCR مربوطه به ترتيب باا اساتفاده از آنازیم هاا ی محادوداثر
MnlI و BanII مورد هضم آنزیمي قرار گرفت .محصاول PCR جهت بررسي چند شکلي rs11771443، طاول ي معاادل 174 جفت باز داشت. بارش آنز یما ي بااMnlI در ژنوتيا پ CC، دو قطعه 117 و 57 جفت بازی ایجاد نمود. درحالي که آناز یم بارآلل T مؤثر نبوده و تنها یا ک باناد 174 جفات باازی روی ژل مشاهده گردید )شکل 1(.

شکل 1. هضم آنزیمي قطعه rs11771443 با آنزیم MnlI. چاهک شماره 4: شکل 2. هضم آنزیمي قطعه 894 G>T با آنزیم BanII. چاهک شماره 1.
مارکر 2اندازه: گيرهموزیی )گوتCC)50 bp، ، چاهک چاهک شماره شماره 31: و 5: هتروزیهموزیگوتCTگوت ، TT. چاهک شماره مارکر چاهک اندازهگيرشمارهی 3): 50 هموزیجفت گوتباز ی(، GG، چاهک چاهک شماره 2شماره و5 : 4: هموزیهتروزیگوت گوت GT .TT،

جدول 1. توالي پرایمرهای مورد استفاده و طول محصول PCR جهت بررسي چند شکلي های rs1799983 ،rs11771443 و VNTR اینترون 4.
نام پرایمر توالي پرایمر اندازه محصول
Rs11771443- F
Rs11771443-R 5 ′-CACAATGCCAGGCTCACACC-3 ′
5 ′-TTGCTGGGAACATTTATATCTGAG-3 ′ 174bp
Rs1799983-F
RS1799983-R 5 ′- CAGGAAACGGTCGCTTCGAC -3 ′
5 ′- CAGTCAATCCCTTTGGTGCTCAC -3 ′ 138bp
VNTR intron 4-F VNTR intron 4-R 5 ′- AGGCCCTATGGTAGTGCCTTT -3 ′ 5 ′- TCTCTTAGTGCTGTGGTGAC -3 ′ 420bp

طااول محصااول PCR پلااي مورفيساام rs1799983، 138 جفت باز بود. در افراد دارای ژنوتيپ TT در صاورت تيماار بااآنزیم BanII هيچ برشي ایجاد نمي شود و تنها یا ک باناد 138 جفت باازی ایجاد مي کناد؛ ولي در ژنوتيپ GG، قطعاه 138 جفت بازی به دو قطعه 55 و 83 جفت بازی شکسته مي شاود )شاکل 2(. محص ولات هضام آنز یم ي، باا الکتروف ورز رو ی ژل پلي اکریلاميد 12%، از هم تفکيک شده و پا از رنگآميزی باانيترات نقره، نتایج بررسي گردید.
مشاهدات وارد نرم افزار SPSS )نساخه 18( شاد و توز یا ع ژنوتيپ های هر جهش، فراواني هموزیگوت و هتروزیگوت هاا در دو گروه بيمار و شاهد با استفاده از مربع کای پيرسون و تساتدقيق فيشر مورد سنجش قرار گرفت .p-value کمتر از 05/0 به عنوان سطح معني داری در نظر گرفته شد.

یافته ها
در این مطالعاه فراواناي چناد شاکلي هاا ی rs11771443، rs1799983 و VNTR اینت رون 4 در 80 خ انم ب ا سابقهی سقط مکرر و 80 خانم به عنوان شاهد باا روشPCR-RFLP مورد بررسي قرار گرفت .فراواني ژنوتيسي و آللا ي چناد شاکلي rs11771443 در جدول 2 ارایه شده است. فراوانا ي ژناوت يسي مشاهده شده در گروه بيمار و شاهد به ترتيا ب 48% در مقابال57% برای ژنوتيپ CC، 38% در مقابل 36% برای ژنوتيپ CT و 13% در مقابل 7% برای ژنوتيپ TT باود. فراواناي ژناوت يسي مشاهده شده برای این پلي مورفيسم در گاروه بيماار و شااهد،ارتب اط معنا يداری را ب ا س ندرم ساقط مکارر نش ان ناداد )16/0=p(.
فراواني ژنوتيسي پلي مورفيسام rs1799983 در زناان دارا ی سندرم سقط مکارر و زناان گاروه شااهد، باه ترتيا ب 48% در مقاب ل 60% بارای ژنوتياپ GG، 45% در مقابال 35% ب رای ژنوتيپ GT و 7% در مقابل 5% برای ژنوتيپ TT بود. فراوانا ي ژنوتيسي مشاهده شده برای این پلي مورفيسم در گروه بيماار و
جدول 2. فراواني ژنوتيسي، آللي و بررسي سطح معن يداری برای چند شکلي rs11771443 در گروه بيمار و شاهد.
فراواني آلل در کل افراد مطالعه شده فراواني آلل در گروه بيمار فراواني آلل در گروه شاهد آلل
درصد تعداد درصد تعداد درصد تعداد
241 %71 120 %67 121 %75 C
99 %29 58 %33 41 %25 T
p-value OR(95%CI) فراواني ژنوتيپ در کل افراد مطالعه شده فراواني ژنوتيپ در گروه بيمار فراواني ژنوتيپ در گروه شاهد ژنوتيپ
0/16 0/72)0/46-1/14( تعداد
89
63 درصد 52%
%37 تعداد
43
34 درصد 48%
%38 تعداد
46
29 درصد
%57
%36
CC
CT
18 %11 12 %13 6 %7 TT
ار و شاهد. ي rs1799983 در گروه بيم

يداری برای چند شکل بررسي سطح معن فراواني ژنوتيسي، آللي و جدول 3. فراواني آلل در کل افراد مطالعه شده فراواني آلل در گروه بيمار فراواني آلل در گروه شاهد آلل
درصد تعداد درصد تعداد درصد تعداد
247 %74 123 %71 124 %78 G
87 %26 51 %29 36 %22 T
p-value OR(95%CI) فراواني ژنوتيپ در کل افراد مطالعه شده فراواني ژنوتيپ در گروه بيمار فراواني ژنوتيپ در گروه شاهد ژنوتيپ
0/15 0/69)0/41-1/14( تعداد
90
67 درصد
%54
%40 درصد تعداد
42 %48
39 %45 درصد تعداد
48 %60
28 %35
GG
GT
10 %6 6 %7 4 %5 TT
بيمار و شاهد. VNTR اینترون 4 در گروه

ی برای چند شکلي ژنوتيسي، آللي و بررسي سطح معن يدار جدول 4. فراواني فراواني آلل در کل افراد مطالعه شده فراواني آلل در گروه بيمار فراواني آلل در گروه شاهد آلل
درصد تعداد درصد تعداد درصد تعداد
272 %81 133 %83 139 %80 b
62 %19 27 %17 35 %20 a
p-value OR(95%CI) فراواني ژنوتيپ در کل افراد مطالعه شده فراواني ژنوتيپ در گروه بيمار فراواني ژنوتيپ در گروه شاهد ژنوتيپ
0/48 1/20)0/72-2/01( درصد تعداد
10 %6
42 %25 درصد تعداد
5 %6
17 %21 درصد تعداد
5 %6
25 %29
aa ab
115 %69 58 %72 57 %66 bb

شاهد، ارتباط معن يداری را با سندرم سقط مکارر نشاان ناداد )15/0=p؛ جدول 3(. فراوانا ي ژناوت يسي چناد شاکلي VNTR اینترون 4 در جدول 4 ارایه شده است. فراواني ژنوتيسي bb در گروه بيمار 72% و در گروه شاهد 66% ، فراواني ژنوتيسي aa در
گروه بيمار و شاهد 6% و فراواناي ژناوت يسيab در گاروه بيماار 21% و در گروه شاهد 29% بود. همچنين نتاا یج آناال يز آماار ی آزم ون ک ای ارتب اط معن يداری ب ا س ندرم س قط مک رر در جمعيت بيمار و شاهد نشان نداد )48/0=p(.

بحث
نيتریک اکسيد سنتاز اندوتليالي باا تنظايم انقبااض عاروق،
ک اهش فش ار خ ون، ش لکنن دگي عض لات ص اف و ایج اد
لانهگزیني موفق نقش مؤثری در حفا بارداری دارد. مطالعااتمتعددی در مورد ارتباط چند شکلي های ژن eNOS با ساقطمکرر انجام شده است. از آنجا که نتایج واحدی از این مطالعات حاصل نشده است، لذا مطالعه ایا ن ژن و ارتبااط آن باا ساقطمکرر جنا ين، یکا ي از موضاوعات ماورد علاقاه ی پژوهشاگرانمي باشد. در مطالعهی حاضر توزیع فراواني ژنوتيپ ها و آلل های پلي مورفيسم rs1799983 بين زنان گروه کنترل و گروه بيمار اختلاف معني داری نشان ندادند. در این SNP گلوتاميک اسيد در کدون 298 به آسسارتيک اسيد تبدیل مي شود. این تعویض اسيدآمينه با کاهش eNOS و در نتيجاه کااهشNO هماراهبوده و به نوبه ی خود باعث کاهش گشادسازی شریان برکيا الي در دوران بارداری و اخاتلال در گاردش خاون ماادر و جناين مي شود )6،11،12(.
در این تحقيا ق فراوانا ي ژناوت يسي گاروه بيماار و شااهد درافرادی که حامل آلل موتاسيون یافته T هستند نزدیک به هاممي باشد. این یافته حاکي از این امر است که دارا بودن این آلل در افراد بيمار هيچ ارتباطي با افزایش ریسک خطار نادارد. درساال 2006، Suryanarayana و همک اران مطالع اتي جه ت بررسي ارتباط با ين ساقط مکارر و پلاي مورفيسام G>T 894 اگزون 7 ژن eNOS در ميان 145 زن با سابقه سقط مکرر در جنوب هند انجام دادند. نتایج نشان داد که ژنوتيپ GT و TT در گروه بيمار بيشتر از گروه کنترل باود اماا از لحااظ آمااری معناا يدار نباا ود )435/0=PTT=0/482 ،PGT(. همچناا ين مطالع اتي ک ه توس ط Karvela )2008، یون ان(، Zammiti )2007، تونا( و Fan )2007، چين( انجاام گرفات، هماننادتحقيق فوق ارتباط ميان ایا ن پلا ي مورفيسام و ساندرم ساقطمکرر جنين را رد کرده است) 15-13(. این در حالي است کاهدر برخي مطالعات دیگر نظيا ر Luo )2013، چا ين(، Öztürk )2011، ترکيه( و Shin )2010، کره( ارتباط این پلي مورفيسم با سقط مکرر جنين تأیيد شده است )18-16(.
در ای ن تحقي ق، فراوان ي ژنوتي پ GT در اف راد بيم ار ب ا فرک انا ژن وتيسي ای ن ژنوتي پ در اف راد بيم ار در مطالع ات Karvela در یونان برابر باوده و از ساایر جمعيا ت هاا ی بيماار مربوط به Luo در چين، Suryanarayana در جنوب هناد وZammiti در تونا بيشتر است. کم تار ین فرکاانا ژناوتيسي ژنوتيپ TT در بيمار در چين و بيش ترین فرکانا آن در افراد مبتلا به سقط مکرر یونان مي باشد )22-19(.
پلي مورفيسم rs11771443 یکي دیگر از پلي مورفيسم های ژن eNOS است. ارتباط این پلي مورفيسام باا ساندرم ساقطمکرر تنها توسط Luo )2013، چين( مورد مطالعه قرار گرفته است .Luo بيان داشت که این پلي مورفيسم به واسطه تنظا يم رونویس ي eNOS نق ش بحران ي در س قط ایف ا م ي کن د. در مطالعات وی، فرکاانا ژناوتيسي CC در افاراد بيماار با يش از افراد کنترل است که عکا نتيجه تحقيق حاضر بوده و حااک ي از آن اساات کااه فرکااانا ژنااوتيسي rs11771443 تفاااوت معنا ي داری در مقایسا ه با ا گا روه کنتا رل دارد )23،24(، درحااال يکااه در مطالعااه ی حاضاار اخااتلاف معنااي داری در پلي مورفيسم جایگاه rs11771443 بين افاراد دارا ی ساابقه ی سقط مکرر و افراد کنترل مشاهده نشد که نشان دهندهی عادمارتباط معني دار ميان پلي مورفيسم مذکور و ریسک سقط مکرر در جمعيت مورد مطالعه است.
در مطالعات متعددی به بررسي ارتباط با ين پلا ي مورفيسام VNTR اینترون 4 با سندرم سقط مکارر انجاام شاده اسات.
Tempfer و همکاران) 2001( در اتریش مشاهده کردناد کاهفراواني ژنوتيسي ab در گروه بيمار و کنترل اختلاف معني داری دارد )03/0=p(. همچنين مطالعات آن ها نشان داد، در افاراد ی که برای این پلي مورفيسم هتروزیگوت هستند خطر سقط 6/1 برابر گروه کنترل است )6/1OR:( )13(. نتایج مطالعات فان وهمک اران) 2007( در چ ين نش ان داد ک ه فراوان ي ژنوتي پ هموزیگوت و هتروزیگوت aa و ab و همچنين آلل a در گاروهبيمار بالاتر از گروه کنترل بوده و در افرادی که دارای ژنوتيا پ aa و ab هستند خطار ساقط 8/1 برابار گاروه کنتارل اسات )8/1OR:( )16(. ب ه نظ ر م ي رس د در ح املين ab ، س طح سرمي NO کاهش یافته و این افراد را در معرض خطر اختلال در خونرساني به جفت و انفارکتوس قرار دهد. برخي محققين گزارش کرده اند که حاملين این نوع پلي مورفيسم سطح سرمي NO کماي دارند و بيا ان پاروتو ين در آن هاا کااهش ماي یاباد
)15-13(. مطالعا اتي کااه توسااط Shin ،)2011( Öztürk
)2010( و Suryanarayana )2006( انج ام گرفاات، ارتب اطمعني دار بين این پلا ي مورفيسام و ساندرم ساقط مکارر را ردکردن د) 17،12،22(. در تحقيق اتي ک ه زاميت ي و همک اران )2007( انجام دادند به این نتایج رسيدند که ژنوتيپ ab و aa در گروه بيمار بيش از گروه کنترل اسات اماا از لحااظ آمااری معن يدار نيست )26/0=Paa=0/35 ،Pab( )23(. نتایج مطالعاهحاضر نشان داد که چند شکلي VNTR اینترون 4 نيز همانند دو پلي مورفيسم دیگر با سقط مکرر در ارتباط نيست.
در این تحقيا ق فراوانا ي ژناوت يسي گاروه بيماار و شااهد درافرادی که حامل ژنوتيا پ aa هساتند برابار و در افارادی کاهحامل ژنوتيپ ab هساتند نزد یا ک باه هام اسات . ایا ن یافتاه مي تواند حاکي از این امر باشد که در مطالعه حاضر دارا باودنآلل a در افراد بيمار ها يچ ارتبااط ي باا افازایش ریساک خطارندارد. بيش ترین فرکانا ژنوتيسي ژنوتيا پ aa در افاراد بيماار مربوط به Zammiti در تونا مي باشد که تقریبااً باا فرکااناژنوتيسي aa در گروه بيمار و شاهد در تحقيق حاضر برابر است .بيش ترین فرکانا ژنوتيسي ژنوتيپ ab در افراد کنترل مرباوط به Suryanarayana در جنوب هند اسات . نتاا یج در تحقيا ق حاضر نشان مي دهد که فراواني ژناوت يسي ab در گاروه کنتارلجمعيت حاضر و جنوب هند تقریباً مساوی است.

نتيجه گيری
در این مطالعه ارتباط معنا ي داری با ين پلا ي مورفيسام هاا ی مورد بررسي با سندرم سقط مکرر در جامعاه آمااری منتخابوجود نداشت. علت آن مي تواند متفاوت بودن پراکنش آللي در جمعيت های مختلف و یا فراوانا ي پاا یين برخا ي از آلال هاا درجمعيت مورد مطالعه باشد .علاوه بر این ایران کشاور ی اساتکه اقوام مختلفي را در خاود جاای داده و هار قاوم ماي تواناد فرکانا آللي مخصوصي را داشته باشد که در نتایج تأثير گاذار باشد .سومين عامل مؤثر در توجيه نتاا یج متنااقض در جواماعمختلف رژیا م غاذا یي اسات . چارا کاه ماواد غاذایي همچاونکل مپ يچ، اس فنا و ش کلات تل خ ح اوی فلاوونوئي د ب وده و به نوبهی خود باعث توليد NO و گشاد شدن عروق مي شوند.
در نهایت، SNP ها یک استعداد ژنتيکي بارا ی فارد ایجااد مي کنند که باروز ایا ن اساتعداد باه زمي ناه ی ژنتيکا ي فارد وبرهم کنش سایار ژن ها روی یکدیگار و همچنين محياط روی ژن ها بستگي دارد .پيشانهاد ما ي شاود در مطالعاات بعادی بااافزایش جامعهی آماری، سایر ژن ها و ارتباط متقابل آن ها مورد بررسي قرار گيرد.

تشکر و قدرداني
بدی نوسيله از زحمات پرسانل آزما یشاگاه ژنتيا ک پزشاک ي تهران- دکتر اکبری به جهت همکاری صميمانه در اجرای این طرح، تشکر و قدرداني مي گردد. ایا ن پاروژه باا حمایا ت ماال ي آزمایشگاه ژنتيک پزشاک ي تهاران، باا شاماره گرانات 93001 انجام شد.

REFERENCES
121394258476

1. Tang AW, Quenby S. Recent thoughts on management and prevention of recurrent early pregnancy loss. Curr Opin Obstet Gynecol 2010;4(46):45-49.
.2 Emad M, Fadel A. Endothelial nitric oxide synthase (eNOS) gene polymorphism, nitric oxide and progesterone levels in unexplained recurrent pregnancy loss. Int J Chem Life Sci 2013;2(3):1126-1131.
3. Tarek A, Abd Elzaher A. Natural killer cells, macrophages and inflammatory chemokines in recurrent pregnancy loss: Life Sci J 2014;11(2):34-39.
.4 Almawi WY, Guarino BD, Racoubian E, Finan RR. Endothelial Nitric Oxide Synthase gene variants and haplotypes associated with an increased risk of idiopathic recurrent miscarriage. Hum Fertil 2013;16(3):200-206.
.5 Branch DW, Gibson M, Silver R, Clinical practice: Recurrent miscarriage. N Engl J Med )3(63;0102:1740-.7471
.6 Colomba D, Duro G, Corrao S, Argano C, Di Chiara T, Nuzzo D, et al. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study. Immun Ageing 2008; 5(4):1742-4933.
.7 Moshage H. Nitric oxide determinations: Much about no-thing? Clin Chem 1997;43(4):553-.555
.8 Kone BC. Molecular biology of natriuretic peptides and nitric oxide synthases. Cardiovasc Res 2001;51(3):429-.144
.9 Suryanarayana V, Rao L, Kanakavalli M, Padmalatha V, Deenadayal M, Singh L. Recurrent early pregnancy loss and endothelial nitric oxide synthase gene polymorphisms. Arch Gynecol Obstet 2006;274(2):119-124.
.01 Casas JP, Cavalleri GL, Bautista LE, Smeeth L, Steve E, Humphries SE, et al. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular disease. Am J Epidemiol 2006;164(10):921- 935.
11. Hingorani AD. Polymorphisms in endothelial nitric oxide synthase and atherogenesis. Atherosclerosis 2001;154(3): 521-527.
.21 Senthil D, Raveendran M, Shen YH, Utama B, Dudley D, Wang J, et al. Genotype dependent expression of endothelial nitric oxide synthase (eNOS) and its regulatory proteins in cultured endothelial cells. DNA Cell Biol 2005; 24(4):218-.422
.31 Tempfer C, Unfried G, Zeillinger R, Hefler L, Nagele F, Huber JC. Endothelial nitric oxide synthase gene polymorphism in women with idiopathic recurrent miscarriage. Hum Reprod 2001;:)8(611644-.7461
.41 Yamada H, Sata F, Saijo Y, Kishi R, HisanoriMinakami H. Genetic factors in fetal growth restriction and miscarriage. Semin Thromb Hemost 2005;31(3):334-.543
.51 Ledingham MA, Thomson AJ, Young A, Macara LM, Greer IA, Norman JE. Changes in the expression of nitric oxide synthase in the human uterine cervix during pregnancy and parturition. Mol Hum Reprod 2000;:)11(61041-.8401
.61 Fan W, Li SW, Wang Y. Association of genetic polymorphisms in endothelial nitric oxide synthase 3 gene with recurrent early spontaneous abortion. Chin J Med Genet :)1(42;700223-.62
.71 Öztürk E. Nitric oxide levels and endothelial nitric oxide synthase gene polymorphisms in Turkish women with idiopathic recurrent miscarriage. The Turkish-German Gynecological Education and Research Foundation; 2011.
.81 Fábregues F, Balasch J, Manau D, Creus M, Jiménez W, Carmona F, et al. Circulating levels of nitric oxide in successful and unsuccessful implantation after in vitro fertilization and embryo transfer. Relat Estradiol Progesterone 2000;79(7):564-.965
19. Parveen F, Faridi RM, Alam S, Agrawal S. Genetic analysis of eNOS gene polymorphisms in association with recurrent miscarriage among north Indian women. Reprod Bio Med Online 2011;23(1):124-131.
.02 Hefler L, Termpfer C, Bashford MT, Unfried G, Zeillinger R, Scheeberger C, et al. Polymorphisms of the angiotensinogen gene, the endothelial nitric Oxide synthase gene, and the Interleukine-1beta gene promoter in women with idiopathic recurrent miscarriage. Mol Hum Reprod 2002;8(1):95-100.
.12 Shin SJ, Lee HH, Cha SH, Kim JH, Shim SH, Choi DH, et al. Endothelial nitric oxide synthase gene polymorphisms (-786T>C, 4a4b, 894G>T) and haplotypes in Korean patients with recurrent spontaneous abortion. Eur J Obstet Gynceol Reprod Biol 2010;152(1):64-6.
.22 Karvela M, Papadopoulou S, Tsaliki E, Konstantakou E, Hatzaki A, Florentin-Arar L, et al. Endothelial nitric oxide synthase gene polymorphisms in recurrent spontaneous abortions. Arch Gynecol Obstet 2008;278(4):349-352.
.32 Zammiti W, Mtiraoui N, Mahjoub T. Lack of consistent association between endothelial nitric oxide synthase gene polymorphisms, homocysteine levels and recurrent pregnancy loss in Tunisian women. Am J Reprod Immun 2008; 59(2):139-.541
.42 Luo L, Li DH, Wei SG, Zhang HB, Li SB, Zhao J. Polymorphisms in the endothelial nitric oxide synthase gene associated with recurrent miscarriage. Genet Mol Res 2013;12(3):3879-.6883



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید