پژوهنسال ده (شانزمجله دهم، شمارهپژوهشي خرداد2 ، و پي تير دانشگاهدر پي1390 علوم 80، پزشكي صفحات شهيد83 تا 91 بهشتي) تاريختاريخ پذيرشدريافت مقالهمقاله:: 2530/1//5/13891390

بررسي وجود ژنهاي مقاومت بيوسايدي qac A/B و smrدر استافيلوكوكوس
اورئوس هاي به دست آمده از منابع كلينيكي و غير كلينيكي
دكتر جميله نوروزي، دكتر پرويز پاكزاد1، الميرا ابراهيمي2*، رويا رضويپور3
استاد، گروه ميكروبيولوژي، دانشگاه آزاد اسلامي، واحد تهران شمال
دانشجوي كارشناسي ارشد ميكروبيولوژي، دانشگاه آزاد اسلامي، واحد تهران شمال
-9891188126

كارشناس ارشد ميكروبيولوژي، آزمايشگاه محموديه، دانشگاه آزاد اسلامي، واحد تهران شمال چكيده
سـابقه و هـدف : مـصرف گـسترده مـواد بيوسـايدي حـاوي تركيبـات چهارتـايي آمونيـوم (QACs) منجـر بـه پيـدايش سـويههـاي استافيلوكوكسي مقاوم به اين مواد شده است. هدف از اين مطالعه، بررسي حضور ژنهاي مقاومت به مواد بيوسايدي همچـون qac A/B و smrو ارتباط آنها با حضور ژنهاي مقاومت آنتي بيوتيكي در ميان استافيلوكوكوس اورئوسهاي جداسازي شده از منابع مختلف بود.
مواد و روشها: 42 نمونه استافيلوكوكوس اورئوس از منابع كلينيكي، 11 نمونه از مواد لبني غير پاستوريزه و 32 نمونـه از سـوابهـايگرفته شده از بيني افراد سالم، از مجموع 150 نمونه جمع آوري شده، ايزوله گرديد. حساسيت بـه مـاده بيوسـايدي حـاوي ديدسـيل دي متيل آمونيوم كلريد به روش Colorimetric Broth Microdilution سنجيده شد. PCR براي يافتن ژنهاي bla Z ،smr ،qac A/B و mec A انجام گرفت.
يافته ها: 50% از نمونههاي كلينيكي، 36/36% از نمونههاي لبني و 6/15% از نمونههاي بيني با محدوده MIC بين µg/ml 81/7-95/1 به ماده بيوسايدي مقاوم بودند. فراواني ژنهاي qac A/B و smr در 42 نمونه كلينيكي به ترتيـب 04/19% و 2/45% بـود كـه بيـشتر از فراواني آنها (به ترتيب 3/2% و 9/20%) در ساير نمونه ها بود (05/0p<). ژن غالب در ميان نمونههـاي بـ هدسـت آمـده از بينـي،smr بـافراواني 6/15% بود. ارتباط معنيداري بين حضور همزمان حداقل يكي از ژنهاي مقاومت به ماده بيوسايدي با ژن bla Z در نمونههـايكلينيكي (04/0p<) و نمونه هاي ب هدست آمده از لبنيات غير پاستوريزه (024/0p<) مشاهده گرديـد و ايـن در حـالي بـود كـه ارتبـاط معنيداري بين حضور ژنهاي بيوسايدي با ژن mec A بدست نيامد.
نتيجهگيري: نتايج اين پژوهش براي اولين بار در ايران، نه تنها حضور گسترده ژنهاي qac A/B و smr را در استافيلوكوكوس اورئوس مورد بررسي قرار داده است، بلكه حضور ژنsmr را (با فراواني 6/15%) در حاملين بيني اسـتافيلوكوكوس اورئـوس گـزارش مـي نمايـد.
مطالعه حاضر با تأييد مطالعات قبلي، بر وجود ارتباط نزديك بين مقاومت به QACs و مقاومت به پنـي سـيلينهـا تاكيـد دارد. حـضور ژنهايqac در جمعيت استافيلوكوكوس اورئوس و توانايي آنها در توسعه مقاومت بيولوژيك و بروز مقاومت همزمان با آنتي بيوتيكهـا،اهميت استراتژيهاي كنترل عفونت مؤثر را آشكار مينمايد.
-19035233680

واژگان كليدي: استافيلوكوكوس اورئوس، تركيبات چهارتايي آمونيوم، ژن qac A/B ، ژن smr لطفاً به اين مقاله به صورت زير استناد نماييد:
Nowroozi J, Pakzad P, Ebrahimi E, Razavipour R. Detection of biocide resistance genes, qac A/B and smr, among isolated Staphylococcus aureus from clinical and non-clinical sources. Pejouhandeh 2011;16(2):83-91.
16007257

*نويسنده مس ؤول مكاتبات: الميرا اب راهيمي؛ دانشگاه آزاد اسلامي، دانشكده علوم پايه، واحد تهران شمال؛ پست الكترونيك: [email protected]
استافيلوكوكوس اورئوس از جملـه اسـتافيلوكوكوس اورئـوسمقاوم به متيسيلين (MRSA)،كه از ويژگيهاي آن مقاومت بهچندين آنتي بيوتيك است، يكي از مهمترين پاتوژنهايي است كه در ايجاد عفونتهاي اكتسابي از بيمارستان مطرح مـي باشـد . ميباشند(1 و 2). حضور سويه هـاي اسـتافيلوكوك مقـاوم بـهمواد ضد ميكروبي در مراكز بيمارستاني و همچنين در جامعـه،دانشمندان را وادار ساخته است تا مواد دارويي را جهت درمانعفونتهايي كه عامل آنها استافيلوكوكسيهـاي مقـاوم هـستند،توسعه دهند 2(). در سالهاي اخير، تلاشهاي قابـل تـوجهي درجهت ارتقا كنترل عفونت مؤثر در بيمارستانها انجام شـده كـهمنجر به افزايش مصرف دزانفكتانتها و آنتي سپتيكها گـشتهاست (3). ضـدعفوني كننـدههـا بـا پايـه تركيبـات چهارتـايي آمونيوم(QACs) مثل بنزالكونيـوم كلرايـد، سـتيل پريـدينيومكلرايـد، سـتريمايد، پروسـئين و دتيـزور بـه طـور فراوانـي در بيمارستانها جهت ضـد عفـوني كـردن سـطوح و جلـوگيري ازگسترش عفونـت مـصرف مـيشـوند . تـصور بـر آن اسـت كـهگسترش وسيع در مصرف QACs ممكن اسـت موجـب فـشارانتخابي شده و در پيدايش ميكروارگانيزمهـاي مقـاوم بـه ايـنمواد در محيطهاي كلينيكي دخيل باشـد 4(). حـداقل 12 ژنايجاد كننده مقاومت به مواد آنتي سـپتيكي (smr ،qac A-J و nor A) در استافيلوكوكسيها شناسايي شده است 1(، و5 6).
ژنهـايsmr ،qac B ،qac A و nor A بـه طـور معمـول درسويه هاي كلينيكي استافيلوكوكوس اورئوس مشاهده شـدهانـدكه كد كننده پمپهاي دفعي وابسته به نيروي محركه پروتوني
هــستند. ژن هــاي qac B ،qac A و smr معمــولاً بــر رويپلاسميدها يافـت شـدهانـد و(4 10-7). ديگـر ژن هـاي qac همچونqac H ،qac G و qac J در استافيلوكوكهاي بدسـتآمده از دام و مواد غذايي و لبني مشاهده شدهاند و(3 7).
از سوي ديگر، مصرف وسيع آنتيبيوتيكهـا توسـط انـسان وحيوانات منجر بـه توسـعه و گـسترش تعـداد زيـادي شـاخصمقاومت آنتي بيوتيكي در ميان جمعيت باكتريـايي شـده اسـتكه منجر به مشكلات جدي در زمينه سلامت عمـومي گـشتهاست. اين در حاليست كه وجود پتانسيل در پيدايش مقاومـتمتقاطع و همزمان بين ضدعفوني كنندهها و آنتيبيوتيكها كهبه طور وسيعي در حال مصرف هستند خودنمايي ميكند 4( و11). بعضي از مكانيزمهاي مقاومت (همچون سيستم هاي پمپ دفعــي، تغييــر در نفوذپــذيري و تــشكيل بيــوفيلم) بــراي آنتي بيوتيكها و مواد بيوسايدي مشترك است. شـواهد علمـيبه دست آمده از اطلاعات باكتريولوژي، بيوشـيميايي و ژنتيكـيتأكيد دارند كه استفاده از مولكـولهـاي فعـال در محـصولاتبيوسايدي ممكن است در افزايش بروز باكتريهـاي مقـاوم بـهمواد آنتيبيوتيكي دخيل باشند. فـشار اس ترسـي انتخـابي كـهتوسط بيوسـايدها ايجـاد مـيشـود ممكـن اسـت بـه گـزينشباكتريهايي منجر شود كه مكانيزمهاي مقاومت و يا دفع ايـنمواد را بيان ميدارند (12 و 13).
وجـود ژنهـاي مقاومـت بـر روي عناصـر ژنتيكـي متحـرك همچون پلاسميدها (pSK4 ،pST6 وpSK41) و ترانسپوزونهـا(Tn552 و Tn4002) ممكــن اســت بــه گــسترش اپيــدميكمقاومت مابين گونهها منجر گـردد. شاخـصهاي مقاومـتqac همراه بـا ژنهـاي كدكننـده مقاومـت بـه آنتـيبيوتيـك هـايجنتاميــسين، تــري متــوپريم، پنــي سيلين،كانامايــسين وتوبرامايسين بر روي عناصر ژنتيكي متحرك يافت شدهاند 4(). گزارشــهاي بــسياري مبنــي بــر حــضور ژن qac A/B و ژن بتا لاكتاماز (bla Z) بر روي پلاسميدهاي مـشترك وجـود دارد.
در نتيجه قابل تصور است كه مصرفQACs بتواند در گزينشاستافيلوكوكسيهاي مقاوم به پني سيلين دخيل باشد 1(، و4
.(7
اين مطالعه با هدف سنجش حساسيت سويههـاي باكتريـايينسبت به ماده بيوسايدي حاويQACs ، بررسي حضور ژنهاي qac A/B و smr در استافيلوكوكوس اورئوس و ارتباط آنهـا بـاحضور ژنهاي مقاومت آنتي بيوتيكي همچون bla Z و mec A انجام گرفت.

مواد و روشها
150 نمونه (كلينيكي و غير كلينيكي) به طور تـصادفي طـيماههاي بهمن و اسفند سال 1388 از منابع مختلف جمعآوري ش ـدند. 54 نمون ـه كلينيك ي م ـشكوك ب ه اس ـتافيلوكوكوساورئـوس، از بيمـاران مبـتلا بـه سـوختگي بيمارسـتان سـوانح سوختگي مطهري و بيمـاران بـستري در بيمارسـتان شـهدايتجريش و مجتمع درماني حضرت رسـول اكـرم تهيـه شـده وجهت بررسي حضور استافيلوكوكوس اورئوس مورد مطالعه قرارگرفتند. 25 محصول لبني غير پاستوريزه نيز از چنـدين نقطـهاز شهر تهران جمـعآوري شـده و آزمايـشهاي تأييـدي جهـتحضور استافيلوكوكوس اورئوس بـر روي آنهـا صـورت گرفـت. دسته آخر نيز 71 فرد سالم، بدون سابقه بستري در بيمارستان در طي يك ماه گذشته و مصرف اخير آنتيبيوتيك بودنـد كـهجهت بررسي حضور استافيلوكوكوس اورئوس در بينـي، مـوردمطالعه قرار گرفتند. حضور استافيلوكوكوس اورئوس به دنبـالانجام رنگ آميـزي گـرم، كـشت بـر روي محيطهـاي مـانيتولسالت آگار، بلاد آگار، تست DNase و مشاهده توليد كواگولاز و مثبت بودن تست كاتالاز مورد تأييد قـرار گرفـت. سـويههـايبه دست آمده از سوابهاي گرفته شده از مواد غـذايي و لبنـي،
ابتدا بر روي محيط برد پـاركر (Baird parker) بـرده شـدند وبدنبال آن، ساير مراحل شناسايي به شرح فوق صورت گرفـت. سويههـاي كنتـرل اسـتانداردATCC 25923 و PTCC 1112 جهت كنترل كيفيت آزمايشهاي سنجش حساسيت بكار بـردهشدند. مـاده بيوسـايدي ANIOS) Surfanios Citron) حـاوي DDAC) didecyldimethyl ammonium chloride) از شركت آيريا برنا (Ayriaborna) خريداري شد.
،2 3، 5- تــــري فنيــــل تترازوليــــوم كلرايــــد 5-,3,2)Triphenyltetrazolium chloride, TTC) پودر زرد رنگي است كه توسط دهيـدروژناز موجـود در سـلولهـاي زنـده بـه مـادهنامحلول فرمازان (formazan) احيا ميشود و در اين مطالعه به عنوان معرف درسنجش حساسيت به ماده ضد ميكروبي به كار گرفته شد (14).
س نجش ح ساسيت ب ه مـاده بيوسـايدي بـه روش broth microdilution و مطابق با اصـول CLSI در ميكروپليـت هـاي96 خانه اي انجام گرفت (15). تنها استثنا در اين رابطه،TTC بود كه به محيط مولر هينتون براث بـا غلظـت mg/ml 625/0 اضافه گرديد (18-16). سوسپانسيون ميكروبي مشابه كـدورتاستاندارد 5/0 مك فارلند (cfu/ml 108×5/1) تهيه گرديد و بهغلظـت نه ايي cfu/ml 105×5 در ه ر چاه ك رسـانده ش ـد.
mec A و bla Z ،smr ،qac A/B جدول 1- توالي پرايمر ژنهاي
منبع توالي پرايمر نام پرايمر
(١٩) CCACTACAGATTCTTCAGCTACATG qacA/B F
(١٩) CTATGGCAATAGGAGATATGGTGT qacA/B R
Gene bank accession no.(X52593) GTGGAAGTTAGATTGGGATCATAGC mecA F
Gene bank accession no.(X52593) GTCAACGATTGTGACACGATAGC mecA R
(٢٠) GCCATAAGTACTGAAGTTATTGGA smr F
(٢٠) GACTACGGTTGTTAAGACTAAACCT smr R
Gene bank accession no.(X52734) TACAACTGTAATATCGGAGGG blaZ F
Gene bank accession no.(X52734) AGGAGAATAAGCAACTATATCATC blaZ R
بـه مـدت 24-18 سـاعت 35-37 ºC ميكروپليت ها در دمـاينگهداري شدند . تشكيل رسوب صورتي مايـل بـه قرمـز بعـد از
گذشت مدت زمان لازم نـشان از رشـد بـاكتري دارد. آخـرينچاهكي كه در آن عدم رشد مشاهده گرديد به عنـوان حـداقلغلظت مهار كنندگي (MIC) گزارش شد. بدنبال تعيينMIC ، حـداقل غلظ ـت ك ـشندگي (MBC) ه ـر ي ـك از س ويه ه ـاي باكتريايي با انتقال µL 100 از هر چاهك به محيط كشت مولرهينتون آگار و نگهـداري بـه مـدت 24-18 سـاعت در دمـاي ºC 35-37 تعيين گرديد.
جهت استخراج ژنوم باكتريايي استافيلوكوكوس اورئوسهـاي
جداسازي شـد ه، از كيـت MBST DNA extraction اسـتفادهگرديد. جستجو براي يـافتن ژن هـاي bla Z ،smr ،qac A/B و mec A مطابق توالي پرايمرهاي ذكر شده در جدول 1 صـورتگرفت.

واكـنش PCR در حجـم نهـايي µL 25 انج ام شـد. در ايـن واكنش، µL 5/2 بافرµL ،(10×) PCR 1 از مخلوط دزاكـسينوكلئوتيد تري فسفات، µL 5/0 از نمك 2µL ،MgCl 1 از هـرپرايمــر F و µL ،R 5/0 آنــزيم Taq DNA Polymerase و µL 8 ازDNA الگو با يكديگر مخلوط و حجـم نهـايي توسـطآب دوبار تقطير به µL 25 رسانده شد. واكنش در 30 سـيكلمطابق جدول 2 انجام گرفت.
محصولاتPCR به دنبال الكتروفورز بـر روي ژل آگـار 1% وقرارگيري در اتيديوم برمايد، با استفاده از نور UV مورد بررسي قرار گرفتند . اطلاعات بدسـت آمـده توسـط نـرم افـزارSPSS (Version 17) مورد تجزيه و تحليل قرار گرفته شد و بر حسب مـورد از آزمونهـاي كـايدو، آزمـون دقيـق فيـشر وKruskal- wallis استفاده گرديد. 05/0p< معنيدار تلقي گرديد.

يافته ها
از مجمـــوع 150 نمونـــه جمـــع آوري شـــده، 85 مـــورد استافيلوكوكوس اورئوس ايزوله و شناسايي گرديد. از 54 نمونهكلينيكي تهيه شده از بيماران مبتلا به سوختگي و بـستري دربيمارستان، 42 سويه بدنبال انجـام تـستهـاي تشخيـصي بـهعنوان استافيلوكوكوس اورئوس تأييد شدند . از بـين 25 نمونـهگرفته شـده از لبنيـات غيـر پاسـتوريزه، 11 اسـتافيلوكوكوساورئوس ايزوله گرديد. از مجموع 71 فرد مورد مطالعـه در ايـنبررسي نيز، 32 نفر (45%) به عنـوان حامـل اسـتافيلوكوكوساورئوس در بيني خود معرفي شدند.
جدول 2 – مراحل واكنش PCR
زمان (ثانيه) حرارت (ºC) مراحل
180 45
180 45
300 45
180 96
95 96
95
95
95
96 qac A/B

smr

mec A

bla Z Denaturation
45 95 60
60
45 64
61
67 qac A/B smr mec A Annealing

60 55 bla Z 90
90
45 72
72
72 qac A/B smr mec A Extention

90 72 bla Z 420
420
300 72
72
72 qac A/B smr mec A Final extention
420 72 bla Z

شكل 1- سنجش حساسيت به ماده بيوسايدي حاوي QACs به روش براث ميكروديلوشن – تصوير از زير ميكروپليت

مـاده بيوسـايدي حـاوي DDAC طبـق دسـتورالعمل توليـد كننده در غلظـت 25/0% (w/v) تهيـه شـد. در ايـن مطالعـهحــساسيت 85 اســتافيلوكوكوس اورئــوس نــسبت بــه مــادهبيوسايدي سورفانيوس سيترون (Surfanios Citron) سـنجيدهشد (شكل1).
كمينه محدودهMIC سويه هاي باكتريـايي مـورد مطالعـه دراي ن بررس ي، µg/ml 4/0 و بي شينه آن µg/ml 81/7 ب ود. از آنجايي كـه تعريـف واحـدي بـراي “حـد مقاومـت” بـه مـادهبيوسـايدي حـاوي QACs وجـود نـدارد (21)، سـويههـايي از استافيلوكوكوس اور ئوس كـه دارايMIC بـالاتري نـسبت بـهسويههاي كنترل استاندارد بودنـد (µg/ml 95/1≥) بـه عنـوانسويههاي مقاوم بهDDAC قلمداد شدند. از مقايسه ميـانگينMIC سويه هاي متعلـق بـه گروههـاي كلينيكـي، نمونـههـايبدست آمده از لبنيات غير پاستوريزه و نمونههاي جدا شـده ازبيني، نتايج معنـيداري حاصـل گرديـد (05/0p<). نمـودار ،1 نتايج سنجش حساسيت سويههاي باكتريايي نـسبت بـه مـادهبيوسايدي را نشان ميدهد.
بررسي نتايجMBC 85 نمونه فوق حاكي از آن بود كه تمـام نمونهها داراي MBC كمتر از 01/0% (w/v) بودند. به طوري كه 7 نمونـه (23/8%) داراي w/v) %0/0078 MBC) و 78 نمونـه
(76/91%) داراي w/v) %0/0039 MBC) بودنــــد. فراوانــــي ژن هــاي bla Z ،smr ،qac A/Bو mec Aدر 85 نمونــه استافيلوكوكوس اورئوس مورد مطالعه بـه ترتيـب (9) 5/10 ،%
(28) 9/32 ،% (44) 7/51 و% (18) %1/21 بود (شكل 2).
965456225811

.

نمودار 1 – نتايج حداقل غلظت مهار كنندگي ماده بيوسايدي (MIC) بر روي سويههاي استافيلوكوكوس اورئوس (عدد اول از چپ به راست MIC و عدد دوم تعداد نمونههاي ارائه دهنده آن MIC را نشان ميدهد)

ژنهاي qac A/B و smr به ترتيـب در 04/19% و 2/45 از% ژنmec A با ژنهاي مقاومت بيوسايدي مشاهده نشد (نمودار
42 سـويه كلينيكـي اسـتافيلوكوكوس اورئـوس يافـت شـدند. 2).
461010-6941

فراواني ژن هاي qac A/B و smr در43 نمونه باقي، بـه ترتيـب3/2% و 9/20% بود، بطوريكه اختلاف معنـي داري بـين حـضورژن هـاي pqac A/B= 0/015) qac A/B) و psmr=0/02) smr) در نمونههاي كلينيكي و غير كلينيكـي ب دسـت آمـد. حـضور ژنmec A تنها در نمونههاي كلينيكي مـشاهده شـد كـه از نظـرآماري معني دار بود (05/0< P). از بـين 42 نمونـه كلينيكـي،18 نمونـه حامـل ژنmec A (8/42%) و 24 نمونـه (1/57%) فاقـد آن بودنـد. جـستجو بـراي يـافتن ژن هـاي اعطـا كننـده مقاومت به ماده بيوسايدي نيز حـاكي از آن بـود كـه تنهـا دوMRSA (1/11%)، حامل ژن qac A/Bبودند. اين در حالي بود
كه در شش استافيلوكوكوس اورئوس حساس به متـي سـيلين
(MSSA) ژن qac A/B (25%) ياف ت ش د. يـازده MSSA شكل 2 – رديف 1() ژن qac A/Bmec A، رديف 2() ژنsmr bla Z، رديف 3() ژن و رديف 4() ژن
(8/45%) و هشتMRSA (4/44%) حامل ژنsmr بودنـد، بـااين حال ارتباط آماري معنيداري بين حضور و يا عدم حـضور

نمودار 2 – ميزان فراوان ي ژنهايmec A ،smr ،qac A/B و bla Z در نمونههاي كلينيكي
بين حضور همزمان حداقل يكي از ژنهاي مقاومت بيوسايدي با ژنbla Z در نمونههاي كلينيكي ارتباط معني داري (04/0p<) مشاهده گرديد، به طوري كه از 21 نمونه كلينيكيِ حامل حداقل يكي از ژنهاي اعطا كننده مقاومت بيوسايدي، 18 نمونه حامل ژن bla Z بودند. وقوع همزمان ژن هاي qac A/B و smr در 6 نمونه از 42 نمونه كلينيكي (2/14%) مشاهده شد.
نتايج PCRاستافيلوكوكوس اورئوسهاي ايزوله شده از مواد لبني غير پاستوريزه (11 نمونه) نشان داد كه تنها يك نمونه (9%) كه از شير غير پاستوريزه جداسازي شده بود، حامل ژن qac A/B بود. ژن smr نيز در 4 نمونه (36/36%) يافت شد. بين حضور همزمان حداقل يكي از ژنهاي اعطا كننده مقاومت بيوسايدي با ژن bla Z ارتباط معنيداري مشاهده شد (024/0p<). وقوع همزمان ژنهاي qac A/B و smr در يك نمونه 9(%) مشاهده گرديد.
نمونههايي كه از بيني افراد حاصل شـده بودنـد، در مجمـوع
32 نمونه بودند كه 5 مورد آنها حامل ژنsmr (6/15%) بودند. ژن qac A/B در هيچكدام از نمونههـاي بينـي يافـت نـشد. 2 نمونه از 5 نمونه بيني (40%) حامل ژنsmr نيز همزمـان ژنbla Z را دارا بودند، اما ارتباط معنيداري از نظرحضور همزمان آنها حاصل نشد. علاوه بر دو نمونه فوق، حـضور ژنbla Z بـهتنهايي در 12 نمونه ديگر مشاهده شد (جدول 3).

بحث
افزايش بروز عفونتهاي ناشي از اسـتافيلوكوكوس اورئـوس دربيمارستانها، منجر به افزايش آگاهي عمومي از تهديدي گـشتهكه توسط عفونتهاي بيمارستاني ايجاد شده اسـت. هرچنـد بـهنظر مي رسد كه بيوسايدها خط دفاعي اوليه جهت جلوگيري ازگسترش عفونت هستند، امـروزه توجهـات زيـادي بـه مـصرفبيش از اندازه مواد بيوسايدي ضدميكروبي كه منجر به گزينشارگانيزمهاي مقاوم به مواد آنتيبيوتيكي مي شوند بوجود آمـدهاست (22).
از آنجايي كه افراد سالم و حامـل اسـتافيلوكوكوس اورئـوس،نقـش مهمـي در گـسترش ايـن بـاكتري بـه عهـده داشـته و مي توانند به عنوان منبع عفونت تلقي شـوند، در ايـن مطالعـه،بيني 71 فرد داوطلب سالم از جهت حضور اين بـاكتري مـوردبررسي قرار گرفـت. آنچـه كـه باعـث تمـايز مطالعـه حاضـر ازمطالعات ساير محققـان شـده اسـت، بررسـي حـضور ژنهـايمقاومت و همينطور سنجش حساسيت سويههاي بدست آمـدهاز بيني نسبت به ماده بيوسـايدي حـاويQACs بـوده اسـت.
نتايج اين بررسي نشان داد كه از 71 فرد مورد مطالعه، 32 نفر(45%) حامل استافيلوكوكوس اورئـوس در بينـي خـود بودنـد.
حضور ژن mec A در ميان اين دسته از باكتريها يافت نـشد .
در اين مطالعه، از 32 فرد حامل اسـتافيلوكوكوس اورئـوس دربيني،5 نمونه (6/15%) حامل ژنsmr بودند . حـضور ژنsmr در نمونههاي بيني افـراد سـالم ممكـن اسـت بـه علـت فـشارانتخابي باشد كه بدنبال مصرف مواد بيوسايدي مـورد مـصرفعام همانند لوازم آرايشي- بهداشتي حاصل شده اسـت كـه بـهطرز اجتناب ناپذيري با پوست و سطوح مخاطي در تماسانـد .
نتايج محققان ديگري همچونHegstad و همكـارانش نيـز بـراين موضوع تاكيد دارد (23).
در مطالعه اخير، كيفيت اثـر بيوسـايد سـورفانيوس سـيترونحاوي تركيبات چهارتايي آمونيـوم عليـه 85 اسـتافيلوكوكوساورئوس سنجيده شد. كمينه محـدودهMIC نـسبت بـه مـادهبيوسايدي متعلـق بـه سـويه كنتـرل اسـتاندارد و بيـشينه آنمربـوط بـه سـويههـاي حام ل هـر دو ژن مقاومـت بـه مـاده بيوسايدي بـود. سـويه هـايي از اسـتافيلوكوكوس اورئـوس كـه

جدول 3 – فراوان ي ژنهاي مورد بررسي در نمونه ها ي كلينيكي، مواد لبن ي غير پاستوريزه و نمونه ها ي بيني
mec A (تعداد) درصد bla Z (تعداد) درصد smr (تعداد) درصد qac A/B (تعداد) درصد نمونه
42/8 (18) 61/9 (26) 45/2 (19) 19/04 ()8 نمونه هاي كلينيكي 42=N
0 ()0
0 ()0
21/1 (18) 36/36 ()4
43/7 (14) 51/7 (44) 36/36 ()4
15/6 ()5
32/9 (28) 9/09 (1)
0 ()0
10/5 ()9 نمونه هاي حاصل از مواد لبن ي غير پاستوريزه 11=Nنمونه ها ي بيني 32=N مجموع 85=N

MICشان در محـدوده µg/ml 81/7-95/1 بودنـد ، بـه عنـوانسويههاي مقاوم با حساسيت كاهش يافته به مـاده بيوسـايدي قلمـداد شـدند كـه 50% از نمونـه هـاي كلينيكـي، 36/36 از% نمونه هاي حاصل از مـواد لبنـي و 6/15% از نمونـه هـاي بينـيبودند كه در مجموع 2/35% از مجموع 85 نمونه مورد مطالعـهرا تشكيل ميدادند. در سـال 2002 نيـزSidhu و همكـارانشح ساسيت 238 استافيلوكوك سي ب ه دس ت آمـده از من ابع كلينيكــي را نــسبت بــه QACs ســنجيدند (4). 118 ســويه (5/49%) با محدودهMIC بي نµg/ml 8-3 به عنوان مقاوم بهبنزالكونيوم كلرايـد (از تركيبـات چهارتـايي آمونيـوم) گـزارششدند كه با مطالعه حاضر همخواني داشت.
در سال 2001 Bjorland و همكاران تحقيقات مشابهي را بـرروي 55 استافيلوكوكوس اورئوس ايزوله شده از شير دام انجامدادند و حـساسيت آنهـا را نـسبت بـه بنزالكونيـوم كلرايـداز( تركيبـات چهارتـايي آمونيـوم) سـنجيدند (24). از نتـايج ايـنتحقيق، يافتن 3 استافيلوكوكوس اورئوس مقاوم به بنزالكونيومكلرايد (5/4%) بـاµg/ml MIC 3-5/2 بـود. اسـتا فيلوكوكوس اورئوسهايي باµg/ml MIC 1-5/0 نيز حساس به بنزالكونيومكلرايد گزارش شدند. فراواني بيشتر سويههاي مقاوم در مطالعهحاضـر را مـيتـوان بـه علـت تفـاوت در نـوع و غلظـت مـاده بيوسايدي مصرفي، فاصله زماني انجام دو مطالعه و اثر متفاوتماده بيوسايدي بر روي سويههاي اپيدميك هر منطقه دانست.
تمامي نمونه هاي مورد مطالعـه در ايـن بررسـي دارايMBC كمتر از 01/0% (w/v) يعني حـدود 10 تـا 100 بـار كمتـر ازغلظت مصرفي توصيه شده توسـط توليـد كننـده بودنـد. ايـنبدين معناست كه چنانچه اين بيوسايد مطابق با دسـتورالعملتوليد كننده مصرف گردد 100% باكتريها مـيبايـست كـشتهشوند. در مراكز بهداشتي مشكل از آنجـا ناشـي مـيشـود كـهبيوسايدها به نادرستي استفاده ميشوند. مانند مواردي كه قبل از مصرف بيوسايد سطوح از مواد آلي به خوبي عاري نگـشته ودر نتيجه باعث كاهش اثر بهينه ماده بيوسـايدي مـي شـود . از سوي ديگر رشد باكتري ها به شكل بيوفيلم بر روي سـطوح دربيمارستانها، آنها را قادر مي سـازد 10 تـا 1000 برابـر، قـدرتتحمل خود را به بيوسايدها افزايش دهند كه در نتيجه عـامليمهم در شكست روند استفاده از بيوسـايدها جهـت ضـدعفونيكردن مراكز بهداشتي تلقي ميگردد. در سـال 2008، Smith، MBC 94 سويه از استافيلوكوكوس اورئوس را نسبت به مـادهبيوس ايدي Trigene (ح اوي دي دس يل دي متي ل آموني وم كلرايد) سنجيد (3). طبق آزمايـشهاي وي مـشخص شـد كـه تمام نمونه هاي مورد مطالعـه اوMBC كمتـر از 01/0% (w/v) نـسبت بـه مـاده بيوسـايدي داشـتند. نتـايج بدسـت آمـده از مطالعاتSmith با نتايج بدست آمده از ايـن بررسـي مطابقـتداشت.
در مطالعه حاضر ژنهاي smr ،qac A/B وbla Z به ترتيب در 04/19 ،% 2/45% و 9/61% از اس تافيلوكوكوس اورئ وسه اي بدست آمده از منابع كلينيكي يافت شدند. ايـن در حـالي بـودكه ميزان وقوع ژنهاي smr ،qac A/B وbla Z در 43 نمونـهباقي به ترتيـب 3/2%، 9/20% و 8/41% بـود. گـسترش كمتـرژنهاي اعطا كننده مقاومت بهQACs در ميان نمونههاي غيركلينيكي بدست آمده از اين مطالعه را ميتوان به علت مصرفكمتر مواد ضد ميكروبي در محيطهايي غير از مراكز درمـاني وبيمارستانها و در نتيجه كـاهش فـشار انتخـابي از سـوي مـوادبيوسايدي دانست . با اين حال نبايد از نظر دور داشت كه وجودژنهاي اعطا كننده مقاومت در نمونـههـاي غيركلينيكـي نيـزممكن است به گزينش باكتريهاي مقـاوم بـه آنتـي بيوتيـكمنجر گردد. از اين رو نياز اسـت كـه آزمايـشهاي بيـشتري درزمينه جزئيات اثر مجاورت مداوم باكتريها بـا غلظتهـاي كـممواد بيوسايدي صورت گيرد.
در سال 2008،Vali و همكاران، وجود ژنهاي اعطـا كننـدهمقاومت به مواد ضد ميكروبي نظير تركيبات چهارتايي آمونيومو بتا لاكتامها را در ميان 120 سويه كلينيكي اسـتافيلوكوكوساورئوس مقاوم به متي سـيلين (MRSA) بررسـي كردنـد (1). نتايج تحقيق آنهـا حـاكي از حـضور ژنهـاي smr ،qac A/B و bla Z بـ ه ترتيـ ب بـ ا فراوانــي3/8%، 2/44 و% 5/97% در استافيلوكوكوس اورئوس هاي مقاوم به متيسيلين بود 1(). اين نتــايج، بــا فراوانــي 1/11% ژن qac A/B، 4/44% ژن smr و 3/83% ژن bla Z در استافيلوكوكوس اورئوسهـاي مقـاوم بـهمتي سيلين كه از بررسـي حاضـر بدسـت آمـده بـود مطابقـتداشت.
در آزمايش مشابهي كهSmith و همكارانش در سـال 2008 انجام دادند (3)، ميـزان فراوانـي ژنqac A/B ، از مجمـوع 94 استافيلوكوكوس اورئوس كلينيكي، 8/14% گزارش شد كـه بـافراواني 19% ژن qac A/B در اين بررسي همخواني داشـت . در سال 1999 Noguchi و همكاران، ميزان رخداد ژنهـايqac A/B را در 98 استافيلوكوكوس اورئوس مقاوم به متي سـيلين،
10% گزارش كردند كه با فراواني %1/11 ژنqac A/B بدست آمده از اين بررسي مطابقت داشت. Noguchi در همين مطالعه فراواني ژن smr را 20% گزارش كرد كه همانند مطالعه اخير با فراواني بيـشتر نـسبت بـه ژنqac A/B يافـت شـد. در سـال2005 Noguchi و همكاران مطالعه گستردهتري ترتيب دادنـد
(9). آنها حساسيت 894 سويه استافيلوكوكوس اورئوس مقـاومبه متي سيلين را كه از 11 كشور آسيايي جمع آوري شده بـودنسبت به مواد بيوسايدي كاتيوني از جمله تركيبات چهارتـاييآمونيوم سنجيدند و حضور ژنهاي اعطا كننده مقاومت به اينمواد بيوسايدي را نيز مورد مطالعه قرار دادند. از نتـايج بدسـتآمده از بررسـيهاي آنهـا، حـضور 5/38% ژن qac A/B و 28% ژنsmr در كل نمونههاي جمع آوري شـده بـود. در بـين 11 كشور آسيايي مورد مطالعهNoguchi و همكاران، كشور هند بافراواني6/31% ژن smr در مقابل فراوانـي6/2% ژن qac A/B، بالاترين رخداد ژنsmr را دارا بود. در بـاقي كـشورها ايـن ژن qac A/B بود كه در ميان سويه هاي استافيلوكوكوس اورئـوسمقاوم به متيسيلين با فراواني بيشتر يافت شد. بالاترين ميزانفراواني ژن qac A/B، 4/72% بود كه به كشور سـنگاپور تعلـقداشت كه بسيار فراتر از فراوانـي 1/11% ژن qac A/B بدسـتآمده از مطالعه حاضر بود. بررسي ميزان گسترش ژنهاي اعطاكننده مقاومت به مواد بيوسايدي در اروپا نيـز توسـطMayer ب صورت گ سترده در س ال 2001 ب ا مطالع ـه ب ر روي 497 استافيلوكوكوس اورئوس جمع آوري شده از 14 كشور اروپـاييانجام گرفت (19). او ميزان حضور ژنهـاي qac A/B و smrرا به ترتيب 42% و 8/5% عنوان كرد كه با نتايج بدسـت آمـده ازاين بررسـي همخـواني نداشـت. تفاوتهـاي موجـود در ميـزانفراواني ژن هاي اعطا كننده مقاومت در مناطق مختلف كه ذكرآنها رفت را ميتوان به علـت اخـتلاف در گـسترش اپيـدميكسويههاي باكتريايي در منـاطق مختلـف، انتخـاب جمعيتهـايمتفـاوت جهـت مطالع ه و يـا وجـود انـواع گونـاگون از مـوادبيوسايدي مورد مصرف با غلظتهاي متنوع از مواد ضد ميكروبي دانـست كـه موجـب ايجـاد فـشار انتخـابي متفـاوت بـر رويسويه هاي باكتريايي هر منطقه مي شوند.
حضور همزمان ژنهاي qac A/B و smr از ديگـر موضـوعاتمورد بررسي در اين مطالعه بـود. نتـايج ايـن بررسـي از وقـوعهمزمان اين دو ژن در 6 نمونه از 42 نمونه كلينيكي (2/14%) و 1 نمونه از 11 نمونـه حاصـل از مـواد غـذايي و لبنـي (9%) حكايت داشت . حضور همزمان اين دو ژن در 32 سـويه ديگـر مشاهده نشد . وقوع همزمان اين دو ژن بيش از فراواني 1% بودكهMayer در سال 2001 در اسـتافيلوكوكوس اورئـوسهـايكلينيكي گـزارش كـرده بـود (19). همچنـين ايـن ميـزان، ازفراوان ي 1/3% ك ه Noguchi در مجم وع 11 ك شور آس يايي بدست آورده بود بيشتر بود. از بـين كـشورهاي مـورد مطالعـهNoguchi، سنگاپور با دارا بودن بالاترين فراواني وقوع همزمان ايـن دو ژن يعن ي 8/13% در اس تافيلوكوكوس اورئـوس ه اي كلينيكي، بيشترين مطابقت را با نتايج مطالعـه حاضـر داشـت9(). حضور همزمان دو ژنqac ، خود يك مزيت انتخابي اسـتكه در يك سويه باكتريايي مـيتوانـد باعـث محافظـت بيـشتربـاكتري در براب ر مح دوده وس يعتري از م واد بيوس ايدي درمقايسه با وجود تنها يك سيستم دفعي در باكتري گردد.
نكته قابل توجه ديگر در اين بررسي، وقوع همزمـان ژنهـاياعطا كننده مقاومت به مواد بيوسايدي با ژن bla Z بود كه هم در نمونه هاي كلينيكي و هم در استافيلوكوكهاي بدست آمدهاز مواد لبني غير پاستوريزه بـه طـرز قابـل تـوجهي بـارز بـود، بطوريكه به ترتيب 5/87% و 100% از نمونـههـاي كلينيكـي ونمونههاي بدست آمده از مواد لبني غير پاستوريزه و حامل ژنqac A/B، همزمان ژن bla Z را نيز دارا بودند. حضور همزمـاناين ژن ها، نـشاندهنده آن اسـت كـه مـيتوانـد ارتبـاطي بـينمقاومـت بـه QACs و مقاومـت بـه پنـي سـيلينهـا در ميـان استافيلوكوكها وجود داشته باشد كه به گزينش همزمان ايـندو، به دنبال درمان آنتي بيوتيكي و يا در پـي مـصرفQACs جهت ضدعفوني كردن منجر شده است.

در آزمايشي مـشابه در سـال 2008، حـضور همزمـان دو ژنqac A/B و bla Zدر تمـامي 10 سـويه كلينكـي مقـاوم بـهQACs مشاهده شد 1(). نتايج Bjorland نيز از ديگر مـوارديبود كه با گزارش حضور همزمـان دو ژنqac A/B و bla Z در 75% از استافيلوكوكسيهـاي حامـل ژنqac A/B و حاصـل ازشير دام، با مطالعـه حاضـر همخـواني داشـت 7(). در بررسـيSidhu و همكــاران نيــز در ســال 2002، ارتبــاط ژنتيكــي وسيستماتيكي بين مقاومت به بنزالكونيوم كلرايد و پني سـيلينيافت شد ، بطوريكه حدود نيمي از مقاومت بتـا لاكتامـازي كـدشده بر روي پلاسـميد (44%) بـه ژنهـاي مقاومـت بـه مـادهبيوسايدي مربـوط مـيشـدند 4(). مطالعـه حاضـر بـا گـزارشفراواني بيشتر و تأكيد مضاعف بر ارتباط مقاومت بـهQACs ومقاومت به پنيسيلينها با مطالعهSidhu و همكاران همخواني داشت. محققان ديگري همچـونLangsrud وChapman نيـزبر وجود ارتباط بين مصرف مواد بيوسايدي و مقاومت متقـاطعبا آنتي بيوتيكها تأكيد دارند (25 و26).

نتيجه گيري
نتايج اين پژوهش، نه تنها براي اولـين بـار در ايـران حـضور
ژن هاي qac A/B و smr را در استافيلوكوكوس اورئـوس مـوردبررسي قرار داده است، بلكه اين نخستين بار است كـه حـضورژنsmr در استافيلوكوكوس اورئـوسهـاي جداسـازي شـده ازبيني با فراواني بالا گـزارش شـده اسـت كـه نيـاز بـه توجـه وتحقيق بيشتر در زمينه نوع و همچنين ميزان ماده بيوسـايديمصرفي در محصولات بيوسـايدي مـورد مـصرف عـام را طلـبمي كند.
از سوي ديگر در بررسي حاضر ارتباط قابل توجهي بين مقاومت به QACs و مقاومت به پني سيلين بدست آمد. اين موضوع مبين اين مطلب است كه تكامل، همچنان روندي پويا و محافظه كار دارد و استراتژيهاي موفق را برميگزيند. در نتيجه حضور هر كدام از اين شاخصهاي مقاومت ميتواند به گزينش مشترك اين دو بدنبال درمان آنتي بيوتيكي و يا بدنبال مصرف مواد ضد عفوني كننده حاوي تركيبات چهارتايي آمونيوم منجر گردد. از اين رو، حضور ژنهاي qac در ميان جمعيت استافيلوكوكوس اورئوس و توانايي آنها در توسعه مقاومت بيولوژيكيشان و احتمال بروز مقاومت متقاطع با آنتي بيوتيكها، اهميت استراتژيهاي كنترل عفونت مؤثر و استفاده از مواد بيوسايدي در غلظت توصيه شده را تأكيد مي نمايد.

تشكر و قدرداني
بدين وسيله از خانم فلور مظهر، كارشناس ارشد ميكروبيولوژيو ساير كاركنان آزمايشگاه دانشگاه آزاد اسـلامي واحـد تهـرانشمال، واقع در محموديه، مراتـب قـدرداني و تـشكر بـه عمـلمي آيد.
REFERENCES
120781668429

Vali L, Davies SE, Lai LL, Dave J, Amyes SG. Frequency of biocide resistance genes, antibiotic resistance and the effect of chlorhexidine exposure on clinical methicillin-resistant Staphylococcus aureus isolates. J Antimicrob Chemother 2008;61(3):524–32.
Saxena S, Gomber C. Surmounting antimicrobial resistance in the millennium superbug: Staphylococcus aureus. Cent Eur J Med 2010;5(1):12–29.
Smith K, Gemmell CG, Hunter IS. The association between biocide tolerance and the presence or absence of qac genes among hospital-acquired and community-acquired MRSA isolates. J Antimicrob Chemother 2008;61(1):78– 84.
Sidhu MS, Heir E, Leegaard T, Wiger K, Holck A. Frequency of disinfectant resistance genes and genetic linkage with beta-lactamase transposon Tn552 among clinical staphylococci. Antimicrob Agents Chemother 2002;46(9):2797-803.
Noguchi N, Nakaminami H, Nishijima S, Kurokawa I, So H, Sasatsu M. Antimicrobial agent of susceptibilities and antiseptic resistance gene distribution among methicillin-resistant Staphylococcus aureus isolates from patients with impetigo and staphylococcal scalded skin syndrome. J Clin Microbiol 2006;44(6):2119-25.
Russell AD, Suller MT, Maillard JY. Do antiseptics and disinfectants select for antibiotic resistanc? J Med Microbiol 1999;48(7):613–5.
Bjorland J, Steinum T, Kvitle B, Waage S, Sunde M, Heir E. Widespread distribution of disinfectant resistance genes among staphylococci of bovine and caprine origin in Norway. J Clin Microbiol 2005;43(9):4363-8.
Sekiguchi JI, Hama T, Fujino T, Araake M, Irie A, Saruta K, et al. Detection of the antiseptic- and disinfectantresistant genes qacA, qacB and qacC in methicilin resistant Staphylococcus aureus isolated in a Tokyo Hospital. Jpn J Infect Dis 2004;57(6):288-91.
Noguchi N, Suwa J, Narui K, Sasatsu M, Ito T, Hiramatsu K, et al. Susceptibilities to antiseptic agents and distribution of antiseptic-resistance genes qacA/B and smr of methicillin-resistant Staphylococcus aureus isolated in Asia during 1998 and 1999. J Med Microbiol 2005;54(Pt 6):557-65.
Noguchi N, Hase M, Kitta M, Sasatsu M, Deguchi K, Kono M. Antiseptic susceptibility and distribution of antiseptic-resistance genes in methicillin-resistant Staphylococcus aureus. FEMS Microbiol Lett 1999;172(2):24753.
Russell AD, Tattawasart U, Maillard JY, Furr JR. Possible link between bacterial resistance and use of antibiotics and biocides. Antimicrob Agents Chemother 1998;42(8):2151.
Akimitsu N, Hamamoto H, Inoue R, Shoji M, Akamine A, Takemori K, et al. Increase in resistance of methicillinresistant Staphylococcus aureus to beta-lactams caused by mutations conferring resistance to benzalkonium chloride, a disinfectant widely used in hospitals. Antimicrob Agents Chemother 1999;43(12):3042–3.
Walsh SE, Maillard JY, Russell AD, Catrenich CE, Charbonneau DL, Bartolo RG. Development of bacterial resistance to several biocides and effects on antibiotic susceptibility. J Hosp Infect 2003;55(2):98–107.
Cavides L, Delgado J, Gilman RH. Tetrazolium microplate assay as a rapid and inexpensive colorimetric method for determination of antibiotic susceptibility of Mycobacterium tuberculosis. J Clin Microbiol 2002;40(5):1873–4.
Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing; 17th informational supplement. CLSI document M100-S17. PA: 2007.
Mohammadzadeh A, Farnia P, Ghazvini K, Behdani M, Rashed T, Ghanaat J. Rapid and low-cost colorimetric method using 2,3,5-triphenyltetrazolium chloride for detection of multidrug-resistant Mycobacterium tuberculosis. J Med Microbiol 2006;55(Pt 12):1657-9.
Lee DD, Lee1 EY, Jeong SH, Chang CL. Evaluation of a colorimetric broth microdilution method for antimicrobial susceptibility testing using 2,3,5-triphenyltetrazolium chloride. Korean J Clin Microbiol 2007;l0(1):49-53.
Lee SM, Kim J, Jeong J, Park YK, Bai GH, Lee EY, et al. Evaluation of the broth microdilution method using 2,3diphenyl-5-thienyl-(2)-tetrazolium chloride for rapidly growing mycobacteria susceptibility testing. J Korean Med Sci 2007;22:784–90.
Mayer S, Boos M, Beyer A, Fluit AC, Schmitz FJ. Distribution of the antiseptic resistance genes qacA, qacB and qacC in 497 methicillin-resistant and -susceptible European isolates of Staphylococcus aureus. J Antimicrob Chemother 2001;47(6):896–7.
Sasatsu M, Shima K, Shibata Y, Kono M. Nucleotide sequence of a gene that encodes resistance to ethidium bromide from a transferable plasmid in Staphylococcus aureus. Nucleic Acids Res 1989;17(23):10103.
Lambert RJ, Joynson J, Forbes B. The relationships and susceptibilities of some industrial, laboratory and clinical isolates of Pseudomonas aeruginosa to some antibiotics and biocides. J Appl Microbiol 2001;91(6):972–84.
Lambert RJ. Comparative analysis of antibiotic and antimicrobial biocide susceptibility data in clinical isolates of methicillin-sensitive Staphylococcus aureus, methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa between 1989 and 2000. J Appl Microbiol 2004;97(4):699–711.
Hegstad K, Langsrud S, Lunestad BT, Scheie AA, Sunde M, Yazdankhah SP. Does the wide use of quaternary ammonium compounds enhance the selection and spread of antimicrobial resistance and thus threaten our health? Microb Drug Resist 2010;16(2):91-104.
Bjorland J, Sunde M, Waage S. Plasmid-borne smr gene causes resistance to quaternary ammonium compounds in bovine Staphylococcus aureus. J Clin Microbiol 2001;39(11):3999-4004.
Langsrud S, Sidhu MS, Heir E, and Holck AL. Bacterial disinfectant resistance—a challenge for the food industry. Int Biodeterior Biodegradation )4(15;3002:283–90.
Chapman JS. Disinfectant resistance mechanisms, cross-resistance and co-resistance. Int Biodeterior Biodegradation 2003;51(4):271–6.



قیمت: تومان

دسته بندی : پزشکی

دیدگاهتان را بنویسید